Search Strains

More Fields
Strain Species Genotype Add
CGC101 C. elegans lin-4(umn13[lin-4p+SL1(long)+Kozac::mScarlet-I + Lox511I sqt-1(d) hsp::CRE hygR Lox511I])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (long sequence) and Kozac sequence. Heterozygotes are GFP+ mScarlet+ Rollers, and segregate GFP+ mScarlet+ Rollers, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC106 C. elegans lin-4(umn17[lin-4p::mScarlet-I::Lox511I::let-858 3' UTR]) II/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Derived by CRE-meditated excision of SEC in parental strain CGC98. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet. Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain.
CGC107 C. elegans lin-4(umn18[lin-4p::SL1(short)::mScarlet-I::Lox511I::let-858 3' UTR]) /mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Derived by CRE-meditated excision of SEC in parental strain CGC99, leaving myo-2p::wrmScarlet. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (short sequence). Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain.
CGC108 C. elegans lin-4(umn19[lin-4p::SL1long::mScarlet-I::Lox511I::let-858 3'UTR]) II/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Derived by CRE-meditated excision of SEC in parental strain CGC100. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (long sequence). Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ homozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain.
CGC109 C. elegans lin-4(umn20[lin-4p::SL1long::Kozak::mScarlet-I::Lox511I::let-858 3' UTR]) II/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Derived by CRE-meditated excision of SEC in parental strain CGC101. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (long sequence) and Kozac sequence. Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain.
CGC116 C. elegans lin-4(umn27[lin-4p+SL1(short)+Kozak::mScarlet-I + Lox511I sqt-1(d) hsp::CRE hygR Lox511I])/mIn1 [dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Rollers. lin-4 pre-miRNA deletion strain deletion allele in which lin-4 pre-miRNA was replaced by myo-2p::wrmScarlet; includes SL1(short) and Kozak sequence upstream of mScarlet. Heterozygotes are Rol GFP+ mScarlet+ heterozygotes, non-GFP Scarlet+ lin-4 homozygotes, and Dpy GFP+ non-Scarlet mIn1 homozygotes. Maintain by picking Rol GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC117 C. elegans lin-4(umn28[lin-4p+SL1(short)+Kozak::mScarlet-I::Lox511I::let-858 3' UTR])/mIn1 [dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 pre-miRNA deletion strain deletion allele in which lin-4 pre-miRNA was replaced by myo-2p::wrmScarlet; includes SL1(short) and Kozak sequence upstream of mScarlet. Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Derived by CRE-meditated excision of SEC in parental strain CGC116, leaving lin-4p::mScarlet.
CGC118 C. elegans lin-4(umn29[lin-4p+SL1long+Kozak::egl-13-NLS::mScarlet-I::c-myc-NLS + Lox511I sqt-1(d) hsp::CRE hygR Lox511I])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 pre-miRNA deletion strain deletion allele in which lin-4 pre-miRNA was replaced by myo-2p::wrmScarlet; includes SL1(long) and Kozak sequence upstream of mScarlet. Heterozygotes are Rol GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking Rol GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Derived by CRE-meditated excision of SEC in parental strain CGC118, leaving lin-4p::mScarlet.
CGC119 C. elegans lin-4(umn30[lin-4p+SL1long+Kozak::egl-13-NLS::mScarlet-I::c-myc-NLS::Lox511I::let-858 3' UTR])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 pre-miRNA deletion strain deletion allele in which lin-4 pre-miRNA was replaced by myo-2p::wrmScarlet; includes SL1(long) and Kozak sequence upstream of mScarlet. Heterozygotes are GFP+ mScarlet+, and segregate GFP+ mScarlet+ heterozygotes, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Derived by CRE-meditated excision of SEC in parental strain CGC118, leaving lin-4p::mScarlet.
CGC124 C. elegans mir-61(umn35[mir-61p::egl-13-NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.
CGC125 C. elegans mir-61(umn36[mir-61p::egl-13-NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.
CGC126 C. elegans mir-61(umn37[mir-61p+SL1::egl-13-NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.
CGC127 C. elegans mir-61(umn38[mir-61p+SL1::egl-13-NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.
CGC129 C. elegans mir-61(umn39[mir-61p+SL1+Kozak::egl-13-NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.
CGC130 C. elegans mir-61(umn40[mir-61p+SL1+Kozak::egl-13-NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by mScarlet. Generated in parental strain N2.
CGC133 C. elegans lin-4(umn43[lin-4p+SL1sh::egl-13-NLS::mScarlet-I::c-myc-NLS::Lox511I::let-858 3' UTR]) II. Show Description
nuclear mScarlet replacement of lin-4 pre-miRNA. Includes SL1 sequence upstream of mScarlet
CGC134 C. elegans lin-4(umn44[lin-4p+SL1sh+Kozak:egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::Lox511I::let-858 3' UTR]) II. Show Description
Nuclear-localized mScarlet replacement of lin-4 pre-miRNA. mScarlet is tagged with the worm codon-optomized mouse ornithine decarboxylase PEST 422-461 with the following mutations E428A/E430A/E431A. Includes SL1 and kozak sequence upstream of mScarlet.
CGC135 C. elegans let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
CGC136 C. elegans mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
CGC137 C. elegans mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
CGC152 C. elegans mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC153 C. elegans mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC155 C. elegans mir-61&mir-250(umn62[mir-61p::SL1::lox2272::EGL-13NLS::mScarlet-I::SV40NLS:: lox511I sqt-1(d) hsp::CRE HygR lox511I::let-858 3'UTR::lox2722]) V. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs.
CGC156 C. elegans mir-61&mir-250(umn63[mir-61p::SL1::lox2272::EGL-13NLS::mScarlet-I::SV40NLS::Lox511I::let-858 3'UTR::lox2722]) V. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed.
CGC157 C. elegans mir-61&mir-250(umn64[mir-61p::SL1::lox2272]) V. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC and mScarlet-I have been removed.
CGC158 C. elegans mir-61&mir-250(umn65[mir-61p::SL1::EGL-13NLS::lox2272::::mScarlet-I::cMycNLS:: lox511I sqt-1(d) hsp::CRE HygR lox511I::let-858 3'UTR::lox2722]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs.
CGC159 C. elegans mir-61&mir-250(umn66[mir-61p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus
CGC160 C. elegans mir-61&mir-250(umn67[mir-61p::SL1::EGL13NLS::lox2272]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC and mScarlet-I have been removed
CGC161 C. elegans mir-266(umn68[mir-266p::SL1::EGL13NLS::lox2272)] X. Show Description
Deletion of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC162 C. elegans mir-266(umn69[mir-266p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC163 C. elegans mir-271(umn70[mir-271p::SL1::EGL13NLS::lox2272)] X. Show Description
Deletion of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC164 C. elegans mir-271(umn71[mir-271p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC165 C. elegans mir-784(umn72[mir-784p::SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC166 C. elegans mir-784(umn73[mir-784p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-784 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-784 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC167 C. elegans mir-787(umn74[mir-787p::SL1::EGL13NLS::lox2272]) X. Show Description
Deletion of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC168 C. elegans mir-787(umn75[mir-787p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272])]) X. Show Description
mScarlet replacement of mir-787 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-787 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC170 C. elegans mir-788(umn77[mir-788p+SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-788 pre-miRNA via CRISPR/CAS9. Left Flanking: TCTGTGCGTATTACAAATTTTCAGCTGGAA, Right Flanking: GAATAGCAGTTTTCAAAATTGTGAGTTGCT. sgRNA: CTGCAAATGGAAGTTAGAAG.
CGC172 C. elegans mir-799(umn79[mir-799p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-799 pre-miRNA via CRISPR/CAS9. Left Flanking: ATTTTCTATTTATTGGTATAAAATATGTTA, Right Flanking: AAGAAGTACACTTCATATGCTCCTAACAAT. sgRNA: GTGAACCCTGATAAAGCTAG.
CGC173 C. elegans lin-4(umn80[lin-4p::SL1::lox2272::EGL-13NLS::mScarlet-I::cMycNLS:: lox511I sqt-1(d) hsp::CRE HygR lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Weak-nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are Rol+, mScarlet+ GFP+, and segregate Rol+ mScarlet+ GFP+, Lin-4 Rol mScarlet+ non-GFP (umn80 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
CGC174 C. elegans lin-4(umn81[lin-4p::SL1::lox2272::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn81 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
CGC176 C. elegans lin-4(umn83[lin-4p::SL1::EGL-13NLS::lox2272::::mScarlet-I::cMycNLS:: lox511I sqt-1(d) hsp::CRE HygR lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Weak-nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are Rol+, mScarlet+ GFP+, and segregate Rol+ mScarlet+ GFP+, Lin-4 Rol mScarlet+ non-GFP (umn83 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
CGC177 C. elegans lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
CGC180 C. elegans mir-82(umn87[mir-82p+SL1::EGL13NLS::lox2272mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-82 pre-miRNA via CRISPR/CAS9. Left Flanking: TATCATTCTCTCTACTACTAGTGAACTCAT, Right Flanking: TTATCAAGAAAATTCAAGAAAATTCAAAAG. sgRNA: CTGTAGATCACAGAGAAAAC.
CGC181 C. elegans umnDf1[mir-35p+SL1::EGL13NLS::lox2272] II. Show Description
Deletion of mir-35, mir-36, mir-37, mir-38, mir-39 and mir-40 miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-35 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar. Left Flanking: CCTCTCCTAATTTCCATTCCCAACTATTAT, Right Flanking: GCTCTTTTTTTGCTGTTTTTAAACTTAAAC. sgRNA #1: ACTGTGGAAGAAACCAGCAA. sgRNA #2: GGTGAAAAATCACCTAGGTC.
CGC182 C. elegans umnDf2[mir-35p+SL1::EGL-13-NLS::lox2272::mScarlet-I::cMycNLS::smu-2 3' UTR::lox2272] II. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-35, mir-36, mir-37, mir-38, mir-39 and mir-40 miRNAs via CRISPR/CAS9. Left Flanking: CCTCTCCTAATTTCCATTCCCAACTATTAT, Right Flanking: GCTCTTTTTTTGCTGTTTTTAAACTTAAAC. sgRNA #1: ACTGTGGAAGAAACCAGCAA. sgRNA #2: GGTGAAAAATCACCTAGGTC.
CGC183 C. elegans mir-1829.1(umn88[mir-1829.1p+SL1::EGL13NLS::lox2272])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Deletion of mir-1829.1 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-1829.1 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP arrested larvae (umn88 homozygotes) and Mec(Unc) GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+. Left Flanking: TGCTAAATCCTTTGTTCAGTTATTATAAGT, Right Flanking: ACATTTTTGGATTGGCAAAGTTGTAGTACT. sgRNA: GTTCAGTTATTATAAGTAAG.
CGC184 C. elegans mir-1829.1(umn89[mir-1829.1p+::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I was inserted in place of the endogenous mir-1829.1 pre-miRNA via CRISPR/CAS9. No mScarlet-I expression is seen under standard growh conditions. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP umn88 homozygotes (arrest stage/phenotype undertemined) and Mec(Unc) GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+. Left Flanking: TGCTAAATCCTTTGTTCAGTTATTATAAGT, Right Flanking: ACATTTTTGGATTGGCAAAGTTGTAGTACT. sgRNA: GTTCAGTTATTATAAGTAAG.
CGC98 C. elegans lin-4(umn10[lin-4p::mScarlet-I + Lox511I::let-858 3'UTR sqt-1(d) hsp::CRE hygR Lox511I::let-858 3'UTR])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet. Heterozygotes are GFP+ mScarlet+ Rollers, and segregate GFP+ mScarlet+ Rollers, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC99 C. elegans lin-4(umn11[lin-4p+SL1(short)::mScarlet-I + Lox511I::let-858 3'UTR sqt-1(d) hsp::CRE hygR Lox511I::let-858 3'UTR])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. lin-4 deletion allele in which lin-4 pre-miRNA (II, lin4:5902254..5902347) was replaced by mScarlet with SL1 (short sequence). Heterozygotes are GFP+ mScarlet+ Rollers, and segregate GFP+ mScarlet+ Rollers, non-GFP mScarlet+ lin-4 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ mScarlet+ and check for correct segregation of progeny to maintain. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
cku-80;let-418 C. elegans Show Description
Increase in apoptotic nuclei and defective in RAD-51 removal. Decreased number of offspring.