| DR706 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-280(m259) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
|
|
| DR709 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-279(m261) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLets. The DpyLets are adult steriles. Maintain by picking semi-Dpy.
|
|
| DR710 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-277(m262) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpys, Uncs and Lets. Lethal mid-larval. Maintain by picking semi-Dpy.
|
|
| DR711 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-273(m263) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
|
|
| DR715 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-284(m267) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. Lethal early larval. Maintain by picking semi-Dpy.
|
|
| DR717 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-286(m269) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc and DpyLet. The DpyLet are adults which lay eggs that do not hatch. Maintain by picking semi-Dpy.
|
|
| DR767 |
C. elegans |
unc-17(e113) unc-5(e53)/dpy-13(e184) ama-1(m118) let-288(m306) IV. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Unc, and DpyLets. DpyLets are adult steriles. Maintain by picking semi-Dpy.
|
|
| DR787 |
C. elegans |
dpy-13(e184) ama-1(m118) let-276(m240)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, DpyLet and dead eggs. Lethal early larval. Maintain by picking semi-Dpy.
|
|
| DR795 |
C. elegans |
dpy-13(e184) ama-1(m118) let-276(m239)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, and dead eggs. Homozygous let-276 are dead eggs. Maintain by picking semi-Dpy.
|
|
| DR942 |
C. elegans |
let-278(m265) dpy-13(e184) ama-1(m118)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, DpyLet and dead eggs. The DpyLets are Sterile adults. Maintain by picking semi-Dpy.
|
|
| EAG25 |
C. elegans |
eagIs6[*fxIs10] ujIs113 II. Show Description
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. H2::mCherry marks germline nuclei. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.
|
|
| EG9876 |
C. elegans |
unc-119(ox819 oxTi1126) III. Show Description
oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
| EG9881 |
C. elegans |
unc-119(ox819) F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Integrated Cas9 transgene linked to unc-119(ox819). Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
| EG9882 |
C. elegans |
F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
| EG9887 |
C. elegans |
W01A8.6(oxTi1128) I; unc-119(ox819) III. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
| EG9888 |
C. elegans |
W01A8.6(oxTi1128) I. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Outcrossed to remove unc-119 mutation. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
|
|
| EU1472 |
C. elegans |
let-99(or204) IV; him-5(e1490) V. Show Description
let-99(or204) is temperature-sensitive, maternal-effect, embryonic-lethal. Nearly completely penetrance of lethality at 26C. Viable at 15C. Maintain at 15C. Reference: Goulding MB, et al. J Cell Biol. 2007 Sep 24;178(7):1177-91.
|
|
| EU363 |
C. elegans |
let-99(or81) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc.
|
|
| EU404 |
C. elegans |
rol-1(e91) mig-14(or78)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Uncs and Rollers. or78 zygotic effects: Pv, mild Unc, many explode at vulva upon reaching adulthood. or78 maternal effects: endoderm (E) transformed into mesoderm (MS) in early embryo, severe morphogenesis defect. mig-14, mom-3, pvl-2, and let-553 are the same gene.
|
|
| EW12 |
C. elegans |
mig-14(ga62) II. Show Description
Egl. Low penetrance embryonic lethal. mig-14, mom-3, pvl-2, and let-553 are the same gene.
|
|
| FF628 |
C. elegans |
let-756(s2613) unc-32(e189) III. Show Description
Homozygous viable and fertile, but slow growing, transparent and small. Originally from BC4253 but outcrossed an additional 7 times.
|
|
| GC771 |
C. elegans |
him-5(e1490) V; naEx57. Show Description
naEx57 [lag-2p::FLP::let-858 3'UTR + ceh-22p::GFP]. Him. Derived by injection of plasmids pGC158 and pCW2.19. Reference: Voutov, R and Hubbard, EJ. Genetics 180(1):103-19 (2008).
|
|
| GC773 |
C. elegans |
unc-119(ed3) III; naIs3. Show Description
naIs3 [(pGC133) hsp-16.41::FLP:::let-858 3'UTR) + Cbr-unc-119(+)].
|
|
| GC817 |
C. elegans |
unc-119(ed3) III; naIs6. Show Description
naIs6 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+) + ceh-22p::GFP)].
|
|
| GC822 |
C. elegans |
unc-119(ed3) III; naEx75. Show Description
naEx75 [(pGC146) hsp-16.2p::FLP::let-858 3'UTR) + Cbr-unc-119(+) + (pCW2.1) ceh-22p::GFP)]. Array was bombarded but did not integrate.
|
|
| GC827 |
C. elegans |
unc-119(ed3) III; naIs7. Show Description
naIs7 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+)]. Does not express ceh-22p::GFP, but unc-119 is rescued.
|
|
| GE2364 |
C. elegans |
let-771(t1554) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
| GE2690 |
C. elegans |
let-733(t1683) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
| GE2935 |
C. elegans |
let-725(t1440) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. t1440 previously called mel-27.
|
|
| GE2946 |
C. elegans |
let-748(t1452) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
| GG25 |
C. elegans |
let-2(g25) X. Show Description
Temperature sensitive. Maintain at 15C. See also CGC 1806.
|
|
| GG30 |
C. elegans |
let-2(g30) X. Show Description
Temperature sensitive. Maintain at 15C. No growth at 20C. See also CGC 1806.
|
|
| GG37 |
C. elegans |
let-2(g37) X. Show Description
Temperature sensitive. Maintain at 15C. See also WBPaper00001806.
|
|
| GG38 |
C. elegans |
mett-10(g38) III. Show Description
Maternal effect temperature sensitive embryonic lethal. Leaky. Maintain at 15C. mett-10 was formerly known as let-42.
|
|
| GLW53 |
C. elegans |
egl-19(utx45[egl-19(A&B)::mScarlet-I-C1::3xMyc] IV. Show Description
Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.
|
|
| GLW79 |
C. elegans |
sod-5(utx61[mScarlet-I-C1::3xMyc::sod-5]) II. Show Description
N-terminal tag of SOD-5 via CRISPR/Cas9 knock-in of mScarlet at sod-5 locus. Insertion verified by PCR and fluorescence. Left flank: 5' tgtgctaacgaaaattttactaaaaggaaa 3'; Right flank: 5' ATGGATATTCTCTCTGATATTGCAAATGCC 3’ (1 silent mutation); sgRNA: tacCTGTGGAAGAACGGCAT; Cas9/sgRNA plasmid: pGLOW122; mScarlet^SEC^3xMyc plasmid: pGLOW129; SEC insertion allele strain: GLW78.
|
|
| GLW85 |
C. elegans |
pqe-1(utx65[mScarlet-I-C1::3xMyc::pqe-1]) III. Show Description
N-terminal tag of PQE-1 via CRISPR/Cas9 knock-in of mScarlet at pqe-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CCAGATGCGAAAGCGAACAG 3’ ; rev – 5’ TGTACTTACCGGAATCGGCG 3’. Left flank: 5' ttaataatcattccagcaagtatctcagcc 3'; Right flank: 5' ATGTTTAATGGCGGCTATGGATCTGGAAAC 3’; sgRNA: atctcagccATGTTTAATGG; Cas9/sgRNA plasmid: pGLOW143; mScarlet^SEC^3xMyc plasmid: pGLOW142; SEC insertion allele strain: GLW84.
|
|
| GLW89 |
C. elegans |
ubql-1(utx69[mScarlet-I-C1::3xMyc::ubql-1]) I. Show Description
N-terminal tag of UBQL-1 via CRISPR/Cas9 knock-in of mScarlet at ubql-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AGGGCGAGAGATTATCGGGA 3’; rev – 5’ CGGATCGTTGAGAATGTGTCC 3’. Left flank: 5' gtcggttttttaatatttctcaaatttaag 3'; Right flank: 5' ATGGCTACAGAGAGTGCACTCATCAAAGTTCACGTGAAATCACCCT 3’ (7 silent mutations); sgRNA: TCAACGTCATACTTGTTCGA; Cas9/sgRNA plasmid: pGLOW134; mScarlet^SEC^3xMyc plasmid: pGLOW145; SEC insertion allele strain: GLW88.
|
|
| GLW91 |
C. elegans |
hrpa-1(utx71[hrpa-1::mScarlet-I-C1::3xMyc]) IV. Show Description
C-terminal tag of HRPA-1 via CRISPR/Cas9 knock-in of mScarlet at hrpa-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ GTCTCCACCAAACGCCTGTA 3’ ; rev – 5’ CTAGCCTGTGTCCCATCAGC 3’. Left flank: 5' AATGGGCCCACGCCCAGGGAGGAAACAGAAACTAT 3' (5 silent mutations); Right flank: 5' TAAattaattccttaagcccctctaagtgt 3’; sgRNA: CAGTGGGCTCATGCTCAAGG; Cas9/sgRNA plasmid: pGLOW144; mScarlet^SEC^3xMyc plasmid: pGLOW153; SEC insertion allele strain: GLW90.
|
|
| GLW93 |
C. elegans |
clic-1(utx73[mScarlet-I-C1::3xMyc::clic-1]) V. Show Description
N-terminal tag of CLIC-1 via CRISPR/Cas9 knock-in of mScarlet at clic-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CTCGTACCAATCGTCCGCAA 3’; rev – 5’ CCATCTTGTTGCTTGGCGAAA 3’. Left flank: 5' ccagggtataaaacacaaaaaaactacaaa 3'; Right flank: 5' ATGTCGGATCCAGTCGCGGATTTTTTGGCT 3’ (1 silent mutation); sgRNA: ctacaaaATGTCGGATCCAG; Cas9/sgRNA plasmid: pGLOW128; mScarlet^SEC^3xMyc plasmid: pGLOW156; SEC insertion allele strain: GLW92.
|
|
| GR1028 |
C. elegans |
mnDp33 (X;IV)/+ IV; let-43(mg49) lon-2(e678) X. Show Description
Animals heterozygous for mnDp33 are Lon and segregate Lon and larval lethals. (Animals which have lost mnDp33 are larval lethal. Animals which are homozygous for mnDp33 are also larval lethal (L1-L2).)
|
|
| GR1029 |
C. elegans |
let-44(mg41) lon-2(e678) X; mnDp31 (X;f). Show Description
Animals with mnDp31 are WT and segregate WT and dead embryos. (Animals which have lost mnDp31 arrest as embryos.)
|
|
| GR1431 |
C. elegans |
mir-84(tm1304) X. Show Description
Enhances retarded differentiation of the hypodermis and exit from the molting cycle caused by mutations in let-7 or its paralogs. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.
|
|
| GR1432 |
C. elegans |
let-7(mg279) X. Show Description
Weakly retarded differentiation of the hypodermis and exit from the molting cycle. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.
|
|
| GR1433 |
C. elegans |
let-7(mg279) mir-84(tm1304) X. Show Description
Retarded differentiation of the hypodermis and supernumerary molt that results in adult lethality. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.
|
|
| GR1452 |
C. elegans |
veIs13 V; let-7(mn112) unc-3(e151) X; mgEx725. Show Description
veIs13 [col-19::GFP + rol-6(su1006)] V. mgEx725 [lin-4::let-7 + ttx-3::RFP]. Pick RFP+ to maintain. mgEx725 rescues lethality of let-7(mn112). Precocious expression of col-19::GFP at the L4 stage. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
|
|
| GR1583 |
C. elegans |
somi-1(mg415) V. Show Description
Adults slightly Dpy. Suppresses defects caused by over-expression of mir-84. Enhances retarded heterchronic phenotypes caused by a weak allele of let-7 or loss of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
|
|
| GR1586 |
C. elegans |
somi-1(tm562) V. Show Description
Adults slightly Dpy. Suppresses defects caused by over-expression of mir-84. Enhances retarded heterchronic phenotypes caused by a weak allele of let-7 or loss of mir-84. Reference: Hayes GD, Riedel CG, Ruvkun G. 2011. Genes Dev. 2011 Oct 1;25(19):2079-92.
|
|
| GS401 |
C. elegans |
let-418(ar113)/unc-46(e177) dpy-11(e224) V. Show Description
Heterozygotes are WT and segregate WT, Steriles with an Everted Vul and DpyUncs. ar113 pka evl-11(ar113). Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS402 |
C. elegans |
let-418(ar114)/unc-46(e177) dpy-11(e224) V. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. ar114 pka evl-11(ar114). Do not distribute this strain; other labs should request it from the CGC.
|
|