| CGC135 |
C. elegans |
let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
|
|
| CGC136 |
C. elegans |
mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
|
|
| CGC137 |
C. elegans |
mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
|
|
| CGC153 |
C. elegans |
mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9. Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
|
|
| JK6140 |
C. elegans |
nos-3(q902) II; qSi380 IV. Show Description
qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3'UTR::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem-loops in its 3'UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The GFP reporter RNA has three functional boxB stem-loops in its 3'UTR; the mCherry reporter 3'UTR has three mutated boxB stem-loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
|
|
| JK6268 |
C. elegans |
qSi380 IV. Show Description
qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3utr::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stemloops in its 3?UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The gfp reporter RNA has three functional boxB stemloops in its 3?UTR; the mCherry reporter 3?UTR has three mutated boxB stemloops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
|
|
| WRM10 |
C. elegans |
sprSi10 II; unc-119(ed3) III. Show Description
sprSi10 [mex-5p::MODC PEST::GFP::H2B::atg-4.2 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM12 |
C. elegans |
sprSi11 II; unc-119(ed3) III. Show Description
sprSi11 [mex-5p::MODC PEST::GFP::H2B::cul-4 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM17 |
C. elegans |
sprSi13 II; unc-119(ed3) III. Show Description
sprSi13 [mex-5p::MODC PEST::GFP::H2B::ets-4 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM18 |
C. elegans |
sprSi14 II; unc-119(ed3) III. Show Description
sprSi14 [mex-5p::MODC PEST::GFP::H2B::hbl-1 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM19 |
C. elegans |
sprSi15 II; unc-119(ed3) III. Show Description
sprSi15 [mex-5p::MODC PEST::GFP::H2B::lin-26 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM22 |
C. elegans |
sprSi16 II; unc-119(ed3) III. Show Description
sprSi16 [mex-5p::MODC PEST::GFP::H2B::mbk-2 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM24 |
C. elegans |
sprSi17 II; unc-119(ed3) III. Show Description
sprSi17 [mex-5p::MODC PEST::GFP::H2B::mex-3 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM27 |
C. elegans |
sprSi19 II; unc-119(ed3) III. Show Description
sprSi19 [mex-5p::MODC PEST::GFP::H2B::set-6 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM30 |
C. elegans |
sprSi20 II; unc-119(ed3) III. Show Description
sprSi20 [mex-5p::MODC PEST::GFP::H2B::usp-14 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
|
|
| WRM5 |
C. elegans |
sprSi5 II; unc-119(ed3) III. Show Description
sprSi5 [mex-5p::MODC PEST::GFP::H2B::glp-1 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
|
|
| WRM6 |
C. elegans |
sprSi6 II; unc-119(ed3) III. Show Description
sprSi6 [mex-5p::MODC PEST::GFP::H2B::glp-1 (GBM UtoC) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
|
|
| WRM7 |
C. elegans |
sprSi7II; unc-119(ed3) III. Show Description
sprSi7 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
|
|
| WRM8 |
C. elegans |
sprSi8II; unc-119(ed3) III. Show Description
sprSi8 [mex-5p::MODC PEST::GFP::H2B::glp-1 (3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
|
|
| WRM9 |
C. elegans |
sprSi9II; unc-119(ed3) III. Show Description
sprS9 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' 3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
|
|