Search Strains

cpIs158 [myo-3p::pat-3sp::2x vhhGFP4::CD8 tm::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs130 [wrt-2p::2x mKate2::PH::3xHA::let-858 3'UTR::tag-168p::HisCl1::tbb-2 3'UTR loxN] II. YPET::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. cpIs158 expresses a membrane-anchored anti-GFP nanobody (Morphotrap) in body wall muscles. This version of Morphotrap consists of extracellular 2x vhhGFP4 fused to a human CD8 transmembrane domain and intracellular 2x mTurquoise2. Endogenously tagged EGL-20::YPET::3xFlag is efficiently sequestered by the Morphotrap transgene (the transgene functions as expected for Wnt), leading to Q neuroblast migration defects. NOTE: cpIs158/Morphotrap does not capture all YPET-tagged extracellular proteins, so sequestration should be determined empirically. cpIs130 is a single copy transgene expressing a 2x mKate2::PH membrane marker in seam cells, Q neuroblasts, and many hypodermal cells, and HisCl1 expression from the tag-168 upstream intergenic sequence. Expression of HisCl1 from the single copy insertion does not appear to be sufficient for immobilizing animals. cpIs158 was inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs130 was inserted at Chr II:8420157-8420243 near ttTi5605. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.

Healthy and appears grossly WT. This allele is a 1563 bp deletion of sequences AATTGAGTAGACAAC....GTGTCTTAAATAT. Removes almost all of the 2nd RGS domain. Previously known as cec-9.

Deletion removes 1465 bp. Removes start site and majority of RGS domain. Has beginning and end sequences AAAAAGATCGAATATCGGTTGT...TATGACGTAGCACAATATCAGG.

231 bp deletion removes all of exons 2 and 3 and throws the remaining portion of the proten (which contains the RGS domain) out of frame. Deletion endpoints are: GCAGCTCACGGAGCCCGGAGTT...CACCGTCGCCAAGACTTAGGTA.

This deletion removes most of exon1, all of exon 2, and most of exon 3. It removes a good chunk of the protein region, including the RGS domain.

Heterozygotes are WT. Animals which have lost the duplication are Unc and homozygous for rgs-7. Animals which are homozygous for the duplication are dead. Unc is temperature sensitive. vs92 is a 361 bp deletion which removes the 3' splice site of exon 6, all of exon 7 and half of exon 8. All of the deleted region is within the RGS domain.

A deletion in F22B7.7 corresponding to base pairs #9512-9815 in the published C. elegans cosmid F22B7 sequence (Genbank accession #L120180. Predicted protein F22B7.7 is part of a family of 2-pore domain potassium channels.

xsSi3 [GFP::utrophin + Cbr-unc-119(+)].  Superficially wild-type.  Carries a germline-expressed actin probe derived from the calponin homology domain of utrophin.  

xsSi5 [pie-1p::GFP::ani-1(AH+PH)::pie-1 3'UTR + Cbr-unc-119(+)] II. The RhoA biosensor consists of GFP fused to the C-terminal portion of C. elegans anillin, which contain its conserved region (AH) and pleckstrin homology (PH) domain. It lacks the N-terminal myosin- and actin-binding domains but retains its RhoA-binding domain. [NOTE: xsSi5 was originally published as mgSi5.] References: Tse YC, et al. Mol Biol Cell. 2012 Oct;23(20):4020-31.

mcIs50 [lin-26p::vab-10(actin-binding domain)::GFP + myo-2p::GFP + pBluescript]. Reference: Gally C, et al., Development. 2009 Sep;136(18):3109-19.

Deletion of K09F5.5, a putative SET-domain-encoding gene. From 2002 deletion library. This deletion removes from the middle of the second exon to the middle of the fourth exon. It is predicted to remove exons that encode the AWS, SET and PostSET domains.

Gain-of-function allele. Spontaneous shrinker, jerky, Unc. G925A, V309M in the pore lining domain. References: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. Stawicki TM, et al. Curr Biol. 2011 May 24;21(10):883-8.

Heterozygotes are WT and segregate WT, Lon Males, early L1 larval arrested animals (n1456 homozygotes) and dead eggs. n1456 is an early nonsense mutation in the extracellular domain of EGL-15/FGFR (Q268 STOP).

Excretory canal defect. Large fluid-filled cysts appear randomly along the excretory canal, especially at the tips: 100% penetrant. Cysts often visible as clear spots by low-power microscopy. Shortened canals. Smaller cysts in amphid sheath. Stop mutation in 2nd Ras-like IRGP domain. Encodes homologue of human IRGC. [NOTE (08/2025): The correct genotype of this strain is exc-1(rh26), not exc-3(rh26) as previously described.]

qyIs570 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)] X. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP.

qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP in netrin null mutant background (ev400).

qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.

pkEx467 [acy-2(+) + rol-6(su1006)]. pk465 was isolated from a chemical deletion library and has a deletion of the first catalytic domain and the two multiple transmembrane regions of the predicted ACY-2 protein. The phenotype of pk465 is early larval lethality. The lethal phenotype of pk465 is rescued in NL1242 by a transgene containing WT acy-2 (cosmid C10F3) and rol-6.

Aldicarb resistant. Lethargic Unc - jerky especially in backward movement. Low pumping rate. Molecular lesion for md247 is a 20 bp duplication yielding a frameshift mid-way through the transmembrane domain.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. TPR domain deleted in the endogenous ogt-1 locus using CRISPR/Cas9; Sanger sequence confirmed. The TPR domain deletion (128 aa - 583 aa) ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Defective gpdh-1p::GFP induction in the hypodermis and intestine during hypertonic stress. Constitutive col-12p::DsRed expression. Impaired adaptation to hypertonic stress. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

TPR domain deleted in the endogenous ogt-1 locus tagged with C-terminal GFP. The TPR domain deletion spans 128 aa - 583 aa. OGT-1(delta-TPR)::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. The TPR domain deletion ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules at a reduced rate compared to wild type immediately after 1 min 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in hsf-1(sy441) hypomorph. drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in the background of balanced hsf-1(ok600). drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP ok600 homozygotes (not rescued by drSi28), very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

ot941[che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying ot63 null alllele and tagged with GFP (che-1::SEC-GFP::TEV::3xFLAG). che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.

ot1193 is a CRISPR-engineered mutation of a small unc-39 auto-regulatory region containing a cluster of several predicted homeodomain binding sites in the endogenously-tagged unc-39(syb4537) reporter strain. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1 in the V1 to V4 lineages. Missense mutation (L68F) affecting a conserved leucine residue in the helix-loop-helix domain.

otIs3 [gcy-7::GFP + lin-15(+)]. che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. otIs3 was derived by integration of adEx1288 [gcy-7::GFP + lin-15(+)]. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.

Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Endogenous eif-2D locus tagged with 3xFLAG. The SUI1 domain of the endogenous EIF-2D locus has been deleted and replaced with 3xFLAG via CRISPR/Cas9 gene editing. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821

Deletion of the cup homology domain (CHD; 196-217aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.

Deletion of the coiled coil domain (CC; 664-691aa) in the endogenously-tagged ifet-1 locus; mMaple tag inserted at the C-terminus. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.

CRISPR/Cas9-engineered deletion of Lectin domain within endogenously-tagged LAT-1A. Internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reduced brood size and high levels of embryonic and larval lethality. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.

mcIs50 [lin-26p::vab-10(actin-binding domain)::GFP + myo-2p::GFP + pBluescript]. Variably Abnormal with body shape defects and bobbed tail at all stages. Reference: Vuong-Brender TTK, et al. PLoS One. 2018 Feb 21;13(2):e0193279.

Y1A5A.1. Homozygous. lim domain. Outer Left Sequence: aggaagcacagactgggaga. Outer Right Sequence: caaatgcttccgtttccatt. Inner Left Sequence: ctgctcgtgtgtgtgtgttg. Inner Right Sequence: tcgtagcattgatcgtcgtc. Inner primer WT PCR product: 2569. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

rpIs3 [gcy-33p::GFP]. vsIs33 [dop-3::RFP] V. Loss of BAG neuron specification. egl-46(rp4) is a point mutation that causing a single amino acid change (C185Y) in the zinc finger domain of EGL-46; it behaves like a null for BAG specification phenotypes.

e1563 homozygotes are superficially wild-type in appearance, development, and behavior. e1563 is a strong, dominant suppressor of UNC-17 G347R mutations (including e245, e359, p300). Molecular details: e1563 corresponds to an I97D (att>>gat) missense mutation in the SNB-1 transmembrane domain. Reference: Sandoval GM, et al. Nat Neurosci. 2006 May;9(5):599-601.

e995 homozygotes are superficially wild type in appearance, development, and behavior. e995 is a strong, dominant suppressor of UNC-17 G347R mutations (including e245, e359, p300). e995 corresponds to G84E (gga>>gaa) in the SUP-1 transmembrane domain. PCR method for scoring the e995 mutation in individual worms is presented in the Supporting Information File of Mathews et al., 2012. [Note: although it has been suggested that unc-123 and sup-1 represent the same gene (Walthall et al. 1993), sequence analysis demonstrated no molecular lesions at the sup-1 locus in unc-123 mutants (Mathews et al., 2012). Therefore unc-123 and sup-1 represent different genes.] Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.

Small, slow-growing, coily uncoordinated, jerky going backward, aldicarb- and lannate-resistant. Molecular details: G347R (gga>>aga) in the 9th transmembrane domain of the UNC-17 protein. PCR method for scoring the e245 mutation in individual worms is presented in the Supporting Information File of Mathews et al., 2012.

Severing and tagging of endogenous locus with trans-splicing ICR and GFP using CRISPR/Cas9. Pharynx and body muscles are green fluorescent and visible by dissection fluorescence microscopy. Severing is located upstream of kinase domain. Please contact Ryan Littlefield prior to publishing work using this strain.

pwIs503 [vha-6p::mans::GFP + Cbr-unc-119(+)]. This strain expresses an intestine-specific GFP marker for the Golgi apparatus (a fragment of C. elegans alpha-mannosidase II (F58H1.1, first 82 aa including signal sequence/TM-anchor domain as in Rolls et al., 2002). This fusion protein is expressed under the control of the vha-6 promoter.

Egl, with defects in HSN migration, and HSN and PVQ axon guidance. Crispr/Cas9 induced mutation in Ring1 domain with epigenetic effects on neurodevelopment. Amino acid substitution that likely disrupts interaction with a specific substrate, resulting in a phenotype comparable to a complete gene deletion. Reference: Pierce SB, et al. Proc Natl Acad Sci U S A. 2018 Feb 13;115(7):1558-1563.

gaSi300 [rps-0p::YFP-DD + Cbr-unc-119(+)] I. Expresses YFP tagged at the C terminus with a destabilizing domain (ecDHFR, mutated to function at 20C). YFP expression is absent in normal culture conditions, but expressed in the presence of the stabilizing ligand trimethoprim. Reference: Cho U, et al. PLoS One. 2013 Aug 22;8(8):e72393.

zcIs4 [hsp-4::GFP] V. Animals contain a missense mutation (G739R) in the kinase domain of ire-1. They are unable to induce hsp-4(BiP0 in response to tumincamycin, or heat shock.

he314[pie-1p::GLO-ePDZ::mCherry::smu-1::tbb-2 3'UTR] II. e259[eft-3p::PH::eGFP::LOV::tbb-2 3'UTR]) IV. Superficially wild-type. CRISPR/Cas9 was used to create insertion alleles he314 and he259 insertions into N2 background at sites of known MosSCI insertions ttTi5605 and cxTi10816, respectively. ePDZ–LOV system transgenes allow use of blue light to control protein heterodimerization, in this case, membrane recruitment of ePDZ-tagged proteins of interest. Germline-optimized cytosolic ePDZ::mCherry-tagged SMU-1 (GLO-ePDZ::mCherry::SMU-1), and membrane-bound LOV2 domain fused to a pleckstrin-homology domain (PH::eGFP::LOV). GLO-ePDZ::mCherry is a germline-optimized variant coded to be less prone to silencing in the germline. Reference: Fielmich LE, et al. eLife 2018 Aug 15;7:e38198. doi: 10.7554/eLife.38198.

ceh-6(mg60) is lethal. Maintain by picking WT and check that it throws 1/4 Dpys. mg60 is a 1.3 kb deletion that removes part of the conserved POU-specific domain. PCR with primers PCR6-5 GAA-TTC-ATG-AAA-TCG-GAG-GCG-T (->) and PCR6-3 GTG-AGA-AGT-GAA-GAG-GAT-TGT-A (<-) yields a band of about 1.6 kb instead of 280 bp as in N2. Backcrossed more than 10 times; in addition, the left arm of LG I was recombined with lin-28 to remove the mutator locus.

Endogenous lem-3 locus carries GFP tag and two misense mutations in conserved residues [Y556A G558A] of GIY-YIG nuclease domain. Homozygous viable, though [Y556A G558A] mutants exhibit increased embryonic lethality after irradiation and abolished localization of GFP::LEM-3 at the midbodies. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.

let-99(dd17) contains a 647bp deletion with the flanking sequences aatttttaggaagtttccagaaatttttcc / CAAGGCTCCCACGAAGATTATCGCGATCTA. The deletion removes the N terminus of the open reading frame including the start codon and the DEP domain. Heterozygotes are GFP+ in the pharynx. dd17 is a maternal effect lethal mutation.

let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation.

Morphological changes in the rays, especially transformation of ray 6 into a thickened shape. Appearance of abnormal protuberances around rays. Closed structure of the fan. Impaired mating ability. Exons 8-10 of the adt-1 gene, encoding most of the metalloproteinase domain of ADT-1, are deleted in adt-1(cn30).