Wild-type morphology. CRISPR/Cas9 engineered 3.38 kB deletion of the che-1 locus. Flank: caaaaacatcacaaaaataa // tataatttactgatacaata Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421

ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).

ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).

che-1(ot75) is a null allele caused by an early STOP codon in exon 1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.

ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 tagged with GFP. Nuclear GFP localization in ASE neurons. Reference: Leyva-Díaz E, et al. Genetics. 2017 Oct;207(2):529-545.

ot941[che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying ot63 null alllele and tagged with GFP (che-1::SEC-GFP::TEV::3xFLAG). che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.

Defective in chemotaxis to Na+, OH-, NaHCO3; partially defective in chemotaxis to CL-; inverted taxis to cAMP.

Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Thermotaxis okay.

Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Thermotaxis okay. 1/2007: new stock received from Michael Ailion due to a recent Dyf mutation appearing in the old CGC stock.

Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Thermotaxis okay.

Defective in chemotaxis to all attractants except pyridine and D-tryptophan. Partial defects in taxis to pyridine, H+(phosphate) and H+(citrate).

Defective in chemotaxis to all attractants except D-tryptophan. Partially defective in response to pyridine, H+(citrate). Thermotaxis okay.

otIs3 [gcy-7::GFP + lin-15(+)]. che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. otIs3 was derived by integration of adEx1288 [gcy-7::GFP + lin-15(+)]. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37.

Chemotaxis abnormal. Temperature sensitive fertilization defective. Maintain at 15C. M-MATING+++ 10-30%WT.

otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.

otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in complete loss of ASE specific cell fate markers. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.

otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.

otIs114 [lim-6p::GFP + rol-6(su1006)]. che-1 mutants result in a complete loss of ASE specific cell fate markers. otIs114, normally expressed in ASEL and excretory gland cells, is lost in ASEL in this mutant.

ntIs1 [gcy-5p::GFP + lin-15(+)] V; integration of adEx1262 [gcy-5p::GFP + lin-15(+)]. otIs151 [ceh-36p::RFP + rol-6(su1006)]. Rollers. Both ASEL and ASER show GFP expression from ntIs1.

otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. Rollers. mCherry expression in ASER and ASEL.

otIs264 [ceh-36p::tagRFP] III. ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. Rollers. Maintain at 15-20C. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.

ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)] V. otIs355 [rab-3::tagRFP] V. Maintain at 15-20C. Rollers. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.

ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. otEx4445 [snb-1::NLS::RFP + pBX]. Rollers. Maintain by picking RFP+ Rollers. Maintain at 20C to maintain extrachromosomal array. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.

otEx4963 [lsy-6p(fosmid delta 150bp downstream)::GFP + ttx-3:mCherry]. Maintain otEx4963 by picking animals with mCherry in the AIY neurons. otIs306 [hsp-16.2::che-1::3xHA + rol-6(su1006)]. Rollers.

otIs583 [gcy-5p*::GFP + ttx-3p::mCherry]. Robust GFP expression in both ASE neurons. mCherry expression in AIY meurons. *This strain contains a short gcy-5 promoter with the CHE-1 binding ASE motif multimerized. GFP expression is strong enough to visualize morphology of both ASE neurons simultaneously. Reference: Patel T & Hobert O. eLife 2017. Etchberger JF, et al. Development. 2009 Jan;136(1):147-60.

otIs587 [gcy-5(fosmid)::SL2::NLS::GFP + ttx-3p::mCherry]. otIs304 [hsp16-2p::che-1::3xHA::BLRP + rol-6(su1006)]. Rollers. GFP reporter tag inserted into gcy-5(+) fosmid. gcy-5 is normally expressed in ASER and RIGL/R neurons, but upon heatshock, expression of CHE-1 induces ectopic gcy-5 expression (the extent of ectopic expression is dependent on the timing of the heatshock). Reference: Patel T & Hobert O. eLife 2017.

ot835 [gcy-5::SL2::mNeonGreen] III. otTi6 [hsp16-41p::che-1::2xFLAG] X. otTi6 is a miniMOS insertion of heatshock inducible che-1. Under normal growth conditions, very dim expression of gcy-5 is observed in the ASER and RIGL/R neurons. Upon heatshock, induction of CHE-1 leads to ectopic expression of gcy-5 (ectopic expression varies depending upon age at heatshock and genetic background).

otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. otEx4149 [cog-1(fosmid)::YFP + elt-2::DsRed]. Maintain by picking animals dsRed(+) in gut nuclei. Rollers. mCherry expression in ASER and ASEL.

otIs232 [che-1p::mCherry(C. elegans-optimized)::che-1 3'UTR + rol-6(su1006)]. Rollers. mCherry expression in ASER and ASEL. otEx4359 [die-1(prom8)::2NLS::YFP + elt-2::DsRed]. Pick animals with dsRed+ intestinal nuclei to maintain otEx4359. otEx4359 carries a minimal (1 kb) promoter driving 2NLS::YFP only in ASEL.

ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp16-2p::che-1::3xHA::BLRP + rol-6(su1006)] V; injected as complex array with Pvu II bacterial DNA. Rollers. Rol is prone to silencing in otIs305, but hsp transgene is still active in Hobert Lab assays. otIs305 is homozygous by PCR analysis (Hobert). Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.

wgIs677 [che-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).

No FITC uptake by phasmids and amphids. Dauer formation defective. Osmotic avoidance defective.

Defective osmotic avoidance. FITC-.

Defective in osmotic avoidance. FITC-. Dauer defective.

Defective osmotic avoidance. FITC uptake abnormal.

Some FITC uptake by amphids but not by phasmids. Hypodermal defect.

N-terminally tagged GFP::CHE-12. Cilia are slightly shorter than WT. GFP fluorescence appears in multiple sensory cilia in the head and phasmid neuron cilia in the tail. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.

Entire che-12 coding sequence deleted and replaced with GFP. This produced a phenotype that is more penetrant than that reported for the original che-12 strain, which introduced a nonsense mutation midway through the coding region. Short amphid and phasmid cilia. Defective chemotaxis to NaCl. Dye-filing defective. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.

C-terminally tagged CHE-12::GFP. Cilia are slightly shorter than WT. GFP fluorescence appears in multiple sensory cilia in the head and phasmid neuron cilia in the tail. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.

Animals are dye-filling negative. A bit sick with about 30% dying during larval development and the others displaying a number of defects in organs/tissues containing hypodermal cells (hypodermis, rectum, vulva, excretory system).

otIs235 [che-1p::mChopti + rol-6(su1006)] V. 2x ASER phenotype. YFP-tag inserted into endogenous lsy-6 locus by CRISPR/Cas9 engineered substitution of the lsy-6 miRNA hairpin for YFP. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421

Osm. FITC filling defective.

otEx5141 [hsp::tbx-37 + hsp::tbx-38 + elt-2p::DsRed]. Maintain by picking animals with dsRed in intestinal nuclei. Transcription factors TBX-37 and TBX-38 are ectopically expressed under control of a heat shock-inducible promoter. otIs235 [che-1p::mCherry + rol-6(su1006)]. otIs252 [lsy-6(+)(fosmid)::YFP + rol-6(su1006)]. Rollers. YFP expression in ASEL.

otEx5449 [fozi-1(fosmid)::YFP + che-1p::mCherry]. otEx5449 is a complex array derived from injection with PvuII-digested E. coli genomic DNA. Onset of fozi-1::YFP expression is around 3-fold stage in embryos. Pick animals with che-1p::mCherry exprssion in ASE neurons to maintain.

Dye-filling mutant.

Dye-filling mutant.

Dye-filling mutant.

Dye-filling mutant.