More Fields
Strain Species Genotype
CZ631 C. elegans juIs14 IV. Show Description
juIs14 [acr-2p::GFP + lin-15(+)] IV. GFP expression in cholinergic motor neurons. Reference: Hallam SJ, et al. Development. 2000 Oct;127(19):4239-52.
CZ9676 C. elegans acr-2(n2595 n2420) X. Show Description
Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.
MT6241 C. elegans acr-2(n2420) X. Show Description
Gain-of-function allele. Spontaneous shrinker, jerky, Unc. G925A, V309M in the pore lining domain. References: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. Stawicki TM, et al. Curr Biol. 2011 May 24;21(10):883-8.
RB1559 C. elegans acr-2(ok1887) X. Show Description
K11G12.2. Homozygous. Outer Left Sequence: GGGTCCGTCCTTTAGACCAT. Outer Right Sequence: TGTTGTTGCTGGAGCAATTC. Inner Left Sequence: CCCTGCATATGTGTGAAACG. Inner Right Sequence: CGCTTTTCCAGTTTTTGACC. Inner Primer PCR Length: 3281 bp. Deletion Size: 2857 bp. Deletion left flank: AAAGAAGTGAAGCGGCTCTACCACCCCGAC. Deletion right flank: AGAAATCATGTTTGGAAAACAAAAATATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
AML320 C. elegans otIs669 V; wtfIs145. Show Description
wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Derived by out-crossing parental strain OH15262 an additional six times before incorporating wtfIs145. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623 Randi F, et al. (2022). A functional connectivity atlas of C. elegans measured by neural activation. arXiv:2208.04790. https://doi.org/10.48550/arXiv.2208.04790
AML462 C. elegans otIs669 V; wtfIs145; wtfIs348. Show Description
wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS-3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keeps plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Derived by out-crossing parental strain OH15262 an additional six times before incorporating other transgenes. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623 Randi F, et al. (2022). A functional connectivity atlas of C. elegans measured by neural activation. arXiv:2208.04790. https://doi.org/10.48550/arXiv.2208.04790
AML508 C. elegans unc-31(wtf502) IV; otIs669 V; wtfIs145; wtfIs348. Show Description
wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS-3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keeps plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. unc-31(wtf502) is a CRISPR-engineered deletion allele. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Derived by out-crossing parental strain OH15262 an additional six times before incorporating other transgenes. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623 Randi F, et al. (2022). A functional connectivity atlas of C. elegans measured by neural activation. arXiv:2208.04790. https://doi.org/10.48550/arXiv.2208.04790
CZ26494 C. elegans juSi364 IV; acr-2(n2420) X. Show Description
juSi364 [unc-17Bp::3xFLAG::eif-3.g::SL2::GFP] IV. GFP expression in cholinergic motor neurons. Convulsing worms. Strain is suitable for neuron-type eCLIP. Reference: Blazie S, et al. Elife. 2021 Jul 29;10:e68336. PMID: 34323215.
OH15205 C. elegans otEx7057. Show Description
Pick TagRFP+ animals to maintain. otEx7057 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Injected into N2. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15262 C. elegans otIs669 V. Show Description
otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15263 C. elegans otIs670 V. Show Description
otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15363 C. elegans otIs669 him-5(e1490) V Show Description
High incidence of males (Him). otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Not known where otIs669 maps relative to him-5. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15430 C. elegans pha-1(e2123) III; otIs669 V. Show Description
Maintain at 15C. Temperature-sensitive. Slow growing. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15493 C. elegans pha-1(e2123) III; otIs669 V; otEx7202. Show Description
otEx7202 [gbb-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15495 C. elegans otIs696. Show Description
otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. Insertion site unknown, but not on LG V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15499 C. elegans pha-1(e2123) III; otIs669 V; otEx7206. Show Description
otEx7206 [mgl-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15500 C. elegans otIs669 V; otIs672. Show Description
otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Bottlenecked 23x for isogenicity. Slow growing. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15511 C. elegans pha-1(e2123) III; otIs669 V; otEx7209. Show Description
otEx7209 [gar-2(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15518 C. elegans pha-1(e2123) III; otIs669 V; otEx7215. Show Description
otEx7215 [mgl-3(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15519 C. elegans pha-1(e2123) III; otIs669 V; otEx7216. Show Description
otEx7216 [gar-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15528 C. elegans him-5(e1490) V; otIs696. Show Description
High incidence of males (Him). otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH15555 C. elegans pha-1(e2123) III; otIs669 V; otEx7244. Show Description
otEx7244 [mgl-2(7.9k)::GFP + inx-6(prom18)::TagRFP + pha-1(+)]. 7.9 kb fragment used in otEx7244 reporter covers full mgl-2 5' promoter region. Maintain at 25C to retain array. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16230 C. elegans otIs670 V; otIs672. Show Description
otIs672 [rab-3::NLS::GCaMP6s + arrd-4:NLS:::GCaMP6s]. otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16289 C. elegans otIs696; wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16290 C. elegans otIs670 V; wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16298 C. elegans him-8(e1489) IV; otIs670 V. Show Description
High incidence of males (Him). otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2 [NOTE: strain does not segregate many male progeny.]
OH16366 C. elegans pha-1(e2123) III; otIs669 V; otEx7484. Show Description
otEx7484 [ceh-13::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. References: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16367 C. elegans pha-1(e2123) III; otIs669 V; otEx7485. Show Description
otEx7485 [ceh-28::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. References: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16368 C. elegans pha-1(e2123) III; otIs669 V; otEx7486. Show Description
otEx7486 [ceh-12::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. References: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16369 C. elegans pha-1(e2123) III; otIs669 V; otEx7487. Show Description
otEx7487 [ceh-17::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. References: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16370 C. elegans pha-1(e2123) III; otIs669 V; otEx7488. Show Description
otEx7488 [ceh-45::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. References: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16371 C. elegans pha-1(e2123) III; otIs669 V; otEx7489. Show Description
otEx7489 [nsy-7::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. References: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16479 C. elegans pha-1(e2123) III; otIs669 V; otEx7569. Show Description
otEx7569 [ceh-81::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. References: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16480 C. elegans pha-1(e2123) III; otIs669 V; otEx7570. Show Description
otEx7570 [ceh-91::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. References: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16481 C. elegans pha-1(e2123) III; otIs669 V; otEx7571. Show Description
otEx7571 [ceh-99::TY1::eGFP::3xFLAG + unc-119(+) + pha-1(+)]. Maintain at 25C to retain array. C-terminal tagged fosmid generated by Transgenome project. Injected with pha-1 rescuing array into NeuroPAL transgene strain. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. References: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH16836 C. elegans otIs669 V; otIs115. Show Description
otIs115 [gcy-12p::GFP]. Integrated promoter fusion reporter for gcy-12. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
OH17294 C. elegans npr-37(syb4440[npr-37::SL2::GFP::H2B]) IV; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogneous locus. Him. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH17766 C. elegans ins-3(syb5421[ins-3::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogneous locus. Him. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH17767 C. elegans ins-6(syb5463[ins-6::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogneous locus. Him. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH17768 C. elegans ins-24(syb5447[ins-24::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogneous locus. Him. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH17826 C. elegans ins-30(syb5526[ins-30::SL2::GFP::H2B]) I; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogneous locus. Him. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH17870 C. elegans lin-11(ot1026) I; unc-17(syb4491[unc-17::T2A::GFP::H2B]) IV; otIs669 him-5(e1490) V. Show Description
Egl. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
OH18062 C. elegans nlp-11(syb4759[nlp-11::SL2::GFP::H2B]) II; otIs669 him-5(e1490) V. Show Description
CRISPR/Cas9 engineered tagged endogneous locus. Him. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH18108 C. elegans otIs669 V; nlp-66(syb4403[nlp-66:SL2:GFP::H2B])X. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-66 locus by CRISPR. Allele generated by SUNY Biotech. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
ZM10339 C. elegans hpIs717; ljIs131. Show Description
hpIs717 [acr-2(s)p::LoxP::eBFP::LoxP::Chrimson::wCherry + unc-17p::Cre + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Red fluorescence in motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10393 C. elegans hpIs592; hpIs595. Show Description
hpIs592 [ttr-39p::Chrimson::wCherry + lin-15(+)]. hpIs595 [acr-2(s)p::GCaMP6s::wCherry + lin-15(+)]. Body relaxation upon green light illumination with ATR. Red fluorescence in D motor neurons. Reference: Lu Y, et al. 2022. Current Biology (In Press).
ZM10823 C. elegans hpIs596; hpIs268. Show Description
hpIs596 [acr-2(s)p::Chrimson::wCherry + lin-15(+)]. hpIs268 [unc-25p::GCaMP3si::SL2 wCherry + lin-15(+)]. Unc (linked to hpIs596). Green and red fluorescence in D-motor neurons. Very weak red fluorescence in A and B motorneurons. Reference: Lim MA, et al. eLife 2016;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782.
ZM9062 C. elegans hpIs583. Show Description
hpIs583 [acr-2(s)p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of A- and B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. acr-2s(p) is a 1.8 kb fragment of the acr-2 promoter driving expression in only A- and B- class motor neurons (described in Jospin et al, 2009 PLoS Biol. Dec;7(12):e1000265). Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
CZ23279 C. elegans juEx7103. Show Description
juEx7103 [unc-17p(beta)::PH::miniSOG(Q103L) + acr-2p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in cholinergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. [NOTE: strain was previously described as carrying ttx-3::GFP, but appears to be ttx-3::RFP instead.]
KP3085 C. elegans nuIs122 IV. Show Description
nuIs122 [acr-2p::pHluorin::snb-1 + myo-2p::dsRed2] IV. Integrated transgene expressing synaptopHluorin under a cholinergic promoter for imaging motor neuron synapses.