| TV24661 |
C. elegans |
dma-1(wy1246[dma-1::GFP]) I; wyIs581 IV. Show Description
wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. GFP tag inserted into endogenous dma-1 locus after DMA-1 transmembrane domain and before cytoplasmic tail. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
|
|
| TV25625 |
C. elegans |
dma-1(wy1246[dma-1::GFP])) I; wyIs853 V; wyIs910 X. Show Description
wyIs853 [ser-2(prom3)::mCherry::rab-7 + odr-1p::GFP] V. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. GFP tag inserted into endogenous dma-1 locus after DMA-1 transmembrane domain and before cytoplasmic tail. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
|
|
| TV26950 |
C. elegans |
dma-1(wy1286[dma-1::tagRFP]) I; rab-7(wy1390) II; wyIs910 X. Show Description
wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. tagRFP tag inserted into endogenous dma-1 locusafter the DMA-1 transmembrane domain and before cytoplasmic tail. rab-7(wy1390) = endogenous GFP-FLPon-RAB-7. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
|
|
| TV26971 |
C. elegans |
rab-11.1(wy1389[GFP::FLP::rab-11.1]) dma-1(wy1286[dma-1::tagRFP]) I; wyIs910 X. Show Description
wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. tagRFP tag inserted into endogenous dma-1 locus after the DMA-1 transmembrane domain and before cytoplasmic tail. GFP::FLP tag inserted into endogenous rab-11.1 locus. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
|
|
| TX773 |
C. elegans |
teIs65 II; unc-119(ed3) III; him-3(e1147) IV. Show Description
teIs65 [pie-1p::GFP::plk-1(PBD) + unc-119(+)] II. Maintain at 25 degrees and by picking the most brightly fluorescing animals to avoid silencing of the transgene. teIs65 contains GFP fused to the PLK-1 protein-binding domain. Derived from injection of pRL1216. Reference: Nishi Y, et al. Development. 2008 Feb;135(4):687-97.
|
|
| UL768 |
C. elegans |
pes-1(leDf1) IV. Show Description
No obvious altered phenotype. Deletion removes 1.9 kb from within pes-1, including more than half of the forkhead domain encoding region.
|
|
| UP4013 |
C. elegans |
bli-4(cs281) I; csEx919. Show Description
csEx919 [WRM069E05 + sur-5p::GFP]. Pick GFP+ to maintain. bli-4(cs281) is a null allele and causes embryonic lethality. csEx919 contains a bli-4(+) fosmid WRM069E05 and rescues bli-4 lethality. cs281 is a 1nt deletion causing a frameshift before the peptidase domain. GTGGGGAACCAATACATACC -> GT-GGGAACCAATACATACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
|
|
| WH170 |
C. elegans |
eff-1(oj55) II. Show Description
Loss of cell fusion in hypodermis (epithelial fusion failures). Viable and fertile as homozygotes. Tail-spike defect in all young larvae, less visible in older larvae and adults. oj55 appears to cause incomplete loss of function, as many cells fuse in postembryonic development. Homozygous males have tail and mating defects. ES-3. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain.
|
|
| WH171 |
C. elegans |
eff-1(oj55) II; jcIs1 IV. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Loss of cell fusion in hypodermis (epithelial fusion failures). Viable and fertile as homozygotes. Tail-spike defect in all young larvae, less visible in older larvae and adults. oj55 appears to cause incomplete loss of function, as many cells fuse in postembryonic development. Homozygous males have tail and mating defects. ES=3. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Mohler WA, et al. Curr Biol. 1998 Sep 24;8(19):1087-90.
|
|
| WH517 |
C. elegans |
ojIs40. Show Description
ojIs40 [pie-1::mGFP::wsp-1(G-protein binding domain) + unc-119(+)]. Reference: Kumfer et al. (2010) Mol Biol Cell (2):266-77.
|
|
| WH527 |
C. elegans |
cgef-1(gk261) X; ojIs40. Show Description
ojIs40 [wsp-1(G-protein-Binding-Domain)::GFP + unc-119(+)]. Maintain under normal condition. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
|
|
| WH558 |
C. elegans |
chin-1(tm1909)/sC1 [dpy-1(s2170) let(gk597)] III; ojIs40. Show Description
ojIs40 [wsp-1(G-protein-Binding-Domain)::GFP + unc-119(+)]. Maintain under normal conditions. Heterozygotes are WT, and segregate WT, occasional Dpy (non-let recombinant sC1 homozygotes), and nearly sterile tm1909 homozygotes. Pick WT and check for correct segregation of progeny to maintain. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
|
|
| WIN179 |
C. elegans |
wago-4(jog179[PH::3xFlag::GFP::wago-4 *gg620]) II. Show Description
Temperature sensitive: maintenance at 15-20C. Reduced number of progeny at elevated temperatures. PH domain added to the 3xFLAG::GFP-tagged endogenous wago-4 locus in parental strain YY1325. This allele localizes WAGO-4 to the plasma membrane, but de-localization is not complete (some residual germ granule signal is detected).
|
|
| WJA780 |
C. elegans |
unc-54(cc4092[unc-54::GFP::T2A::nonstop]) I.; nonu-1(srf780) III. Show Description
srf780 is a deletion of the Smr nuclease domain of nonu-1. Unc. GFP expression in body wall muscle. Reference: Glover ML, et al. Cell Rep. 2020 Mar 31;30(13):4321-4331.e4. doi: 10.1016/j.celrep.2020.03.023. PMID: 32234470.
|
|
| WRM92 |
C. elegans |
oma-1(spr24[*ne5035]) IV; oma-2(ne5034[AID*::oma-2] neSi101 V. Show Description
neSi101 [sun-1p::TIR1::mRuby::eft-3 3'UTR + Cbr-unc-119(+)] IV. GFP reporter inserted into C-terminus of endogenous oma-1 locus. A triple arginine motif upstream of the oma-1 tandem zinc finger domain is mutated to three alanines. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. When OMA-2 is present, this mutant does not appear to have obvious phenotypes. Auxin-inducible depletion of OMA-2 causes embryonic lethality: animals lay low numbers of nonviable embryos that are often polynucleated and have weak chitin shells. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.
|
|
| WS1137 |
C. elegans |
cpb-3(op234) I. Show Description
High physiological germ-line apoptosis. op234 was originally assigned to gla-1, but cloning revealed it to be a point mutation in cpb-3 causing a C520Y substitution at an invariant cysteine within the conserved C/H domain.
|
|
| WU1563 |
C. elegans |
hizr-1(am285) X. Show Description
Gain-of-function allele: modified ligand binding domain constitutively binds HZA element. High zinc transcriptional activation - constitutive (Zad-c). [NOTE: this strain was previously described as hizr-1(am286); the correct allele name hizr-1(am285).] Reference: Warnhoff K, et al. PLoS Biol. 2017 Jan 17;15(1):e2000094.
|
|
| XR1 |
C. elegans |
abl-1(ok171) X. Show Description
1.5 kb of M79.1 locus is deleted which corresponds to the elimination of exons 8-12, including the kinase domain and 2/3 of the SH2 domains.
|
|
| YA1039 |
C. elegans |
mrt-1(yp2) I. Show Description
yp2 mutation perturbs the MRT-1 DNA-binding domain. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63.
|
|
| ZT29 |
C. elegans |
cec-4(ok3124) cec-5(fj58) IV. Show Description
Maintain at 20C or lower. The cec-4 cec-5 double mutant exhibits partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-4 and CEC-5 are phylogenetically similar to CEC-8. ok3124 is a 374-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-4 (F32E10.2). The ok3124 deletion can be detected by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj58 is a 398-bp deletion located in the gene region corresponding to the N-terminus of CEC-5 (F32E10.6). The fj58 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT33 |
C. elegans |
cec-8(fj63) III. Show Description
No apparent phenotype. The chromodomain protein CEC-8 is phylogenetically similar to CEC-5 and CEC-4. fj63 is a 14-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-8 (Y55B1BR.3). The fj63 deletion can be detected by PCR with the following primers: GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT34 |
C. elegans |
cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV. Show Description
Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZZY637 |
C. elegans |
zzyIs139 II; unc-119(tm4063) III. Show Description
zzyIs139 [his-72p::PH(PLC1delta1)::mCherry::pie-1 3' UTR + unc-119(+)] II. The membrane-specific PH(PLC1delta1) domain, labeled with mCherry, is expressed in all cell membranes.
|
|
| ZZY655 |
C. elegans |
zzyIs139 II; zuIs178; stIs10024. Show Description
zzyIs139 [his-72p::PH(PLC1delta1)::mCherry::pie-1 3' UTR + unc-119(+)] II. zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. The membrane-specific PH(PLC1delta1) domain, labeled with mCherry, is expressed in all cell membranes. Derived by crossing parental strains carrying unc-119(ed3) and unc-119(tm4063). Unknown if either unc-119 mutation is still present in background. Reference: Cao J, et al. Nat Commun. 2020 Dec 7;11(1):6254. doi: 10.1038/s41467-020-19863-x. PMID: 33288755.
|
|
| APL130 |
C. elegans |
ljfSi10 II; egl-17(ljf25[egl-17::mNG::nlg-1 C-terminus]) X. Show Description
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Endogenously membrane tethered allele of EGL-17::mNG that is competent for contact-dependent signaling but does not diffuse extracellularly. egl-17(ljf25) was generated by inserting mNG and the transmembrane and C-terminal domains of NLG-1 at the C-terminus of egl-17. Sex myoblast migration defects, Egl. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
|
|
| BU7222 |
C. elegans |
pat-3(st564) III; kqEx73. Show Description
kqEx73 [pat-3(sp) + rab-3::RFP + cki-1::GFP]. Pick RFP+ to maintain. kqEx73 carries a form of pat-3 gene with splicing defects; rescues pat-3 null allele. pat-3(sp) is a frameshift mutation in the splice acceptor region (ag to aa) that abolishes conserved interaction domains such as the NPxY motifs and creates a splice variant with an extra 19 amino acids. The pat-3(sp) animals not only produce mutant pat-3, but also express the regular splice form due to utilization of an unusual splice acceptor. Abnormal Distal Tip Cell migration and pat-3 gene splicing (intron 7) defects. Reference: Kihira S, et al. PLoS One. 2012;7(8):e42425.
|
|
| DCD214 |
C. elegans |
uqIs24. Show Description
uqIs24 [myo-2p::tagRFP::pab-1]. Expression of tagRFP::PAB-1 in pharyngeal muscles; assembles into stress granules after heat shock (2 hr at 32C) and forms tagRFP::PAB-1 aggregates with age at 20C. Valuable marker for aging and for studying the aggregation of RNA-binding proteins with prion-like domains. Reference: Lechler MC, et al. Cell Rep. 2017 Jan 10;18(2):454-467.
|
|
| GW1480 |
C. elegans |
bqsi433 II; bqSi495 IV; ygIs1. Show Description
bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421
|
|
| GW1482 |
C. elegans |
bqsi433 II; bqSi495 cec-4(ok3124) IV; ygIs1. Show Description
bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421
|
|
| JA1403 |
C. elegans |
unc-119(e2498) III; weIs15. Show Description
weIs15 [pie-1p::GFP::eea-1(FYVEx2) + unc-119(+)]. Phenotypically wild type. Early endosomes in germline and embryos are GFP+. GFP is fused to the tandem FYVE domains of eea-1/T10G3.5, under control of the pie-1 promoter. Grows at any temp, but has bright GFP at 25C.
|
|
| JC2749 |
C. elegans |
flr-4(ut3) X; utEx33. Show Description
utEx33 [flr-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. GFP is localized exclusively to intestinal nuclei because of the nuclear localization signal and lack of FLR-1 membrane spanning domains. Reference: Take-uchi et al.: Proc Natl Acd Sci USA. 1998 Sep 29;95(20):11775-80, Take-uchi et al.: Mol Biol Cell. 2005 Mar;16(3):1355-65, Kobayashi et al.: Genes to Cells 2011 May;16(5):565-75.
|
|
| NC293 |
C. elegans |
acr-5(ok180) III. Show Description
No obvious phenotype. 2 kb deletion of acr-5 produced by Moulder/Barstead at OMRF. Deletion removes all 4 transmembrane domains. This is likely a null allele. Left breakpoint sequence (includes repeated sequence): TTTTTAATTATCCGTAATTTTTTAATTATCCGTAAT. Right breakpoint sequence: AACATCTTTAATCGATTTAT.
|
|
| OH16376 |
C. elegans |
ceh-44(ot1028) III. Show Description
ot1028 = 80bp deletion on Exon 8 (first exon isoform A - isoform with CUT domains), leading to a frameshift and early stop codon in Exon 8 expected to affect only isoform A. Deletion coordinates: +9069 to +9148. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. ot1028 is molecularly identical to ot1031.
|
|
| PHX3691 |
C. elegans |
sqt-3(syb3691[sqt-3::mNG(int)]) V. Show Description
mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
|
|
| PHX5321 |
C. elegans |
bli-4(syb5321[bli-4::SfGFP(int)]) I. Show Description
bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
|
|
| RB1337 |
C. elegans |
hlh-26(ok1453) II. Show Description
C17C3.8 Homozygous. Outer Left Sequence: ccagttccgcctgtaacatt. Outer Right Sequence: ttgccacgactggatattga. Inner Left Sequence: actcacctctgcaactgcct. Inner Right Sequence: agtgtcacacgctgagatgg. Inner Primer PCR Length: 2179. Deletion Size: 983 bp. Additional information from Casonya Johnson 3/2005: the deletion is 983 bases, from base 2254 to 3237 on the cosmid C17C3. The gene C17C3.8 is on the opposite strand, and its coding region is from bases 3237 to 3616. The deletion occurs within the second exon of the gene, so that the first 105 amino acids of the protein are still made. This region contains one of the two HLH domains produced by this protein but eliminates the second one. The first stop codon would allow another 19 amino acids to be added to the peptide. I have pasted the sequence below (the red, underlined sequences are the new nucleotides). MSSSPTSSSS GSPSSHGHRS ETEKQRRDDT NDLLNEFKKI VQKSESEKLS KEEVLFRIVK LLSGIQLHHE SFSTSPGPIR SIKKIKSDRE QVRRNKRVAA YRELR tiknkhlehvfnffelki stop Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| TV13570 |
C. elegans |
unc-119(ed3) III; nrx-1(wy778[unc-119(+)]) V. Show Description
wy778 is a large deletion in the nrx-1 locus that removes the transmembrane and cytoplasmic domains shared by all NRX-1 isoforms and deletes the short isoform entirely. Reference: Maro GS, et al. Neuron. 2015 Jun 17;86(6):1420-32.
|
|
| ZG31 |
C. elegans |
hif-1(ia4) V. Show Description
Healthy and fertile in standard lab conditions, but unable to adapt to 1% oxygen. When hif-1(+) animals are incubated in1% oxygen, >94% will complete embryogenesis and larval development. In contrast, hif-1(ia4) mutants exhibit 66% embryonic lethality and 9% larval lethality in 1% oxygen. The requirement of hif-1 is alleviated if the oxygen level is increased to 2%. The ia4 mutation is a 1231 bp deletion of the second, third, and fourth exons, which encode much of the helix-loop-helix and PAS domains. Analysis of ESTs suggests that there are at least 4 alternatively spliced hif-1 transcripts. The ia4 deletion introduces a frameshift and a premature stop in the three longest forms.
|
|
| ZT3 |
C. elegans |
csr-1(fj54) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.
|
|
| ZT60 |
C. elegans |
csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in this csr-1 null-mutant homozygotes. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. The inversion-based balancer in ZT60 is more amenable to producing csr-1(fj54) homozygous males than a translocation-based balancer (ZT3). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT61 |
C. elegans |
vsra-1(tm1637) I; csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in homozygous tm1637; fj54 double mutants. The vsra-1 mutation enhances the defects caused by the csr-1 mutation. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. tm1637 can be detected by PCR with the following primers: AAGCAGTTCTTCAAGACTGGTC and TTGTCCACTCGCACTTTGTG. The fj54 deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT63 |
C. elegans |
csr-1(fj150) IV. Show Description
RNAi deficient (Rde). Him. Partially-inaccurate paring of meiotic chromosomes. fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT64 |
C. elegans |
csr-1(fj150) IV; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. fj150 is enhanced by the CeRep55 quadruple deletion. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|