Search Strains

stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. mCherry visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. Maintain at 20C or lower. Dauer formation at 25C. mCherry visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10161 [egl-27p::HIS-24::mCherry + unc-119(+)]. Maintain at 20C or higher. Embryonic lethal at 15C. mCherry should be visible at low magnification. Reference: Xu X, Kim SK. PLoS Genet. 2012;8(12):e1003108.

Most defects are similar to bar-1(ga80) single mutant animals [bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.] Increased severity of ray 1 displacement.

Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.

ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced. Neurons visualized with ncIs2.

Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.

Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Heterozygotes are Rollers and segregate Rollers, Hmr inviable embyros and Egl Unc. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. Egg laying defective. LoxN sites in the endogenous swsn-4 locus facilitate inducible knockout of swsn-4. he268 he272 homozygotes are Egl since they cannot form a functioning vulva due to swsn-4 inactivated in the mesoderm lineage by hlh-8p::CRE expression. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730

heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. he273 he287 homozygotes are Egl since they cannot form a functioning vulva due to swsn-8 inactivated in the mesoderm lineage by hlh-8p::CRE expression. LoxN sites in the endogenous swsn-8 locus facilitate inducible knockout of swsn-8. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730

heSi220 [lin-31p::Cre] X. Vulval lineage is marked through activity of a Cre-dependent reporter (blue-to-red switch). All cells in the animal are expressing BFP, except for vulval cells which are expressing mCherry. he317 was inserted into the cxTi10816 site using CRISPR/Cas9. Reference: van der Vaart A, et al. Sci. Adv. 2020 May; 6(21): eaay3823. PMID: 32494730.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of egl-44 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of egl-46 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of egl-13 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of egl-18 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

Heterozygotes are Unc-93 and segregate more Unc-93, yDf10 homozygotes (dead eggs) and Unc-93 Dpy-17 homozygotes (young dpy-17 larvae are easily recognizable as abnormal spindle-shaped things). Difficult to maintain and use. yDf10 apparently causes semi-sterility (a second strain constructed by the Mark Edgley at the CGC, yDf10/qC1, exhibits same sterility), and unc-93 is Egl and difficult to mate into. Some Df homozygotes are laid, but most remain inside the mother.

Heterozygotes are Unc and segregate Unc, dead eggs and temperature sensitive Dpys. At 15C the y228 homozygotes (derived from heterozygous mothers) are WT and most of their progeny are inviable, dying as arrested embryos or as necrotic Uncoordinated and Constipated L1 larvae; a small number of animals survive and develop into Dpy, Egl adults with a protruding vulva. At 25C the y228 homozygotes (derived from a heterozygous mother) are Dpy and Egl and have a protruding vulva; progeny from these animals are inviable and die as embryos or L1 larvae. See also WBPaper00002302.

Dpy. Egl.

Egl. Not temperature sensitive -- can be grown at any temperature.

Temperature-sensitive. Maintain at 15C. Complements other sdc-2 alleles at 15C. At 20C animals are not Dpy or Tra, but there is a low penetrance of lethality, some Egl animals, and some animals will Bag after a couple days of egg-laying. y93 fails to complement other sdc-2 alleles at 25C; homozygotes are Egl,Tra and weakly Dpy at higher temperatures. Shifting embryos (prepared from non-Dpy non-Egl non-Tra gravid adults at 20C) from 20C to 25C is sufficient to alter their phenotype. Reference: Nusbaum C & Meyer BJ. Genetics. 1989 Jul;122(3):579-93.

Heterozygotes are WT and segregate WT, Unc and Dpy (sdc-3/sdc-3). sdc-3 homozygotes exhibit a strong maternal effect lethality->most progeny from homozygotes arrest as L1 larvae--about 14% escape the lethality and develop into Dpy, Egl hermaphrodites.

let-413 [L248P]. Variant edit. Homozygous lethal or sterile deletion balanced by tmC3. Heterozygotes are wild-type mCherry+ and segregate mCherry+ heterozygotes, udn27 homozygotes (arrest stage unknown), and mCherry+ tmC3 homozygotes (Unc-23 Lon-3). Pick viable fertile mCherry+ animals to maintain. ApoI-HF restriction site created by synonymous changes for ease of genotyping.

Truncation allele of sem-5 with complex behavior. About 15% larval lethal, about 75% Egl/Vul. Synthetic Muv in gap-1 background.

Deletion allele. Mildly Unc, low percentage larval lethal, low percentage Egl.

Nonsense allele. Mildly Unc, low percentage larval lethal, low percentage Egl.

Weak hypomorphic allele. Cold-sensitive. Egl, Pvul and sterile at 20C.

M01D7.7, M01D7.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok252 homozygotes (phenotype uncharacterized). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04A2.3. External left primer: TCGAGTTGGGCTCAGTCTTT. External right primer: CAGCGATGATGATGAAGGAA. Internal left primer: GGTAAAAGCTGCCAATCCAA. Internal right primer: CTTGTCCTCACTCCGCTCTC. Internal WT amplicon: 2523 bp. Deletion size: 1747 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11G9.4. External left primer: GGACATTTGTGTTGTGCCAG. External right primer: ACAATTTGGGCGATTGAAAG. Internal left primer: ACAGCCGGCAGATACAGTCT. Internal right primer: GGTGGAATAAACGTCCGCTA. Internal WT amplicon: 2234 bp. Deletion size: 1144 bp. Deletion left flank: GCCGATAGCTTTACTCACCTTTATGAACAT. Deletion right flank: TTTTATTGGCATTTGAAAAGTGGCAATTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58A3.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2314 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CTTGCGCGTGTTTAGTTCTG. External right primer: CAACGCTTCTAAAGCCATCC. Internal left primer: TTTTTGCAGGGTCTTTGGTC. Internal right primer: ACAAGATGGCGTTGTGTCAA. Internal WT amplicon: 2895 bp. Deletion size: 1208 bp. Deletion left flank: GTAGTGCTCGGTCCGGCGGATACGAATTCA. Deletion right flank: TTTTAATTGCGTTTCAGGAAATCGCAGTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0244.2. Slow-growing, and some animals appear sterile or Egl. Tail defects are common, and hermaphrodites can be mistaken for males in extreme cases. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04G2.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3510 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCCCTACCCTACCCTCTG. External right primer: CGACTCCACAGTGCTTTCAG. Internal left primer: GCCCGGTTTTACCCTGTATT. Internal right primer: TTCCGCCTCAAAAGTTTCTC. Internal WT amplicon: 1203 bp. Deletion size: 786 bp. Deletion left flank: AAAATTTTACAAATTAAGCGAATAATACTT. Deletion right flank: GCGATTACAAAATTAATTTGTATTCCTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.1. Egl with vulval blip. Lays few or no eggs. Hermaphrodites may be unmatable; male mating efficiency unknown. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22E12.4. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- Egl adults (ok478 homozygotes). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous lethal or sterile deletion balanced by tmC3. Deletion of 2147 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC3 carries myo-2p::mCherry and is Unc-23 Lon-3. Left flanking sequence: GAAAATAGGCAAAAATATTAAACCGTGAAG; Right flanking sequence: GGAAGTGTCATGTTATGATTGACTCCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2375 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCGCTGTGAAAATCGTTTTACAGGCATCCA. Right flanking sequence: ATTTGTCCATCATGCAGTTCGTTCAAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

C51E3.7. Egl. Hermaphrodites produce cross progeny upon mating. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R13A1.2. Larvae Dpy; adults slow-growing, often Dpyish and Egl. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y62F5A.2, Y62F5A.9. Variable DpyEgl phenotype. Most animals are slightly Dpy and slightly Egl. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T24F1.1. Superficially wild type; some animals sterile, some Egl, some with various other morphological defects. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26C6.1. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok843 homozygotes (early to mid-stage larvae Unc, sometimes Dpy; adults WT length, sometimes sterile, sometimes Egl). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22E12.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk277 homozygotes (probable early larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20F10.1. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok753 homozygotes (slow-growing, Egl, some animals mildly Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41E6.6. Mildly Unc to near-WT (does not back very well); often Egl. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C51E3.7a. Variably Egl, mildly Dpy. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0403.4. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1373 homozygotes (homozygotes are slow-growing, short, Unc, Egl, starve a plate only with difficulty). Viable hemizygous ok1373 males are also segregated. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

vkEx2733 [nhx-2p::NLS-SV40::CemOrange2::NLSegl-13 + myo-2p::GFP]. Wild-type animals expressing NLS(sv-40)::CemOrange2::NLS(egl-13) under the intestinal-specific nhx-2 promoter. The dual NLS localizes to the nucleus. Pick animals with GFP+ pharynx to maintain. Reference: Thomas

Suppressor of activated EGL-4. Reference: Hao Y, et al. PLoS Genet. 2011 May;7(5):e1002065.

Suppressor of activated EGL-4. Reference: Hao Y, et al. PLoS Genet. 2011 May;7(5):e1002065.