More Fields
Strain Species Genotype
VC4382 C. elegans ptr-1(gk5276[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC3[egl-9(tmIs1230)] V. Show Description
Homozygous lethal or sterile deletion balanced by tmC3. Deletion of 2147 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC3 carries myo-2p::mCherry and is Unc-23 Lon-3. Left flanking sequence: GAAAATAGGCAAAAATATTAAACCGTGAAG; Right flanking sequence: GGAAGTGTCATGTTATGATTGACTCCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
JH2787 C. elegans pptr-1(tm3103) V. Show Description
pptr-1(tm3103) is a temperature-sensitive allele. Maintain at 15C. Fully penetrant P granule partitioning defect at 20-24C. Low penetrance of sterilty observed at 24-26C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2791 C. elegans pptr-1(tm3103) V; axIs1448. Show Description
axIs1448 [pie-1p::GFP::H2B::nos-2(wt) 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2794 C. elegans pptr-1(tm3103) V; axIs1462. Show Description
axIs1462 [pie-1p::GFP::pie-1::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2835 C. elegans pptr-1(tm3103) V; axIs1504. Show Description
axIs1504 [pie-1p::LAP::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2839 C. elegans pptr-1(tm3103) V; axIs1522; axIs1929. Show Description
axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. axIs1929 [pie-1p::mCherry::par-2::pie-1 3'UTR + unc-119(+)]. Transgenes are prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2841 C. elegans pptr-1(tm3103) V; axIs1522. Show Description
axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH3064 C. elegans pptr-1(tm3103) V; axIs2076. Show Description
axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3155 C. elegans ltIs37 IV; pptr-1(tm3103) V; meg-3(tm4259) X; axIs1522. Show Description
axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3156 C. elegans ltIs37 IV; pptr-1(tm3103) V; meg-1(vr10) X; axIs1522. Show Description
axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
CB5635 C. elegans ptr-15(e2710) V. Show Description
Resistant to infection by Microbacterium nematophilum (no tail swelling). Abnormal lectin staining. ptr-15 also known as bus-13.
CB7151 C. elegans him-8(e1489) IV; ptr-15(e2710) V. Show Description
Him. Bus (resistant to M. nematophilum); hypersensitive to Leucobacter Verde1. References: Gravato-Nobre et al. (2005) PMID: 16079230. Hodgkin et al (in preparation).
CB7174 C. elegans ptr-15(e2710e3062) V. Show Description
Intragenic missense revertant. Partly resistant to Leucobacter Verde1. Reference: Stroud et al. (2013) IWM2013Abstract. ptr-15 also known as bus-13.
CB7505 C. elegans him-8(e1489) IV; ptr-15(cr52) V; eEx730. Show Description
eEx730 [ptr-15(+) + sur-5p::GFP]. Pick GFP+ to maintain. Him. Lethal 1118bp deletion allele of ptr-15 rescued by eEx730. Non-GFP animals will be dead eggs and dead hatchlings. References: O’Rourke et al. (in revision 2024), Kuwabara et al. (in prep.)
CB7517 C. elegans ptr-15(cr52) lon-3(e2175) V; eEx730. Show Description
eEx730 [ptr-15(+) + sur-5p::GFP]. Pick GFP+ to maintain. Lon. Non-GFP animals will mostly be dead eggs and dead hatchlings, but can segregate rare GFP-negative viable ptr-15 lon-3 homozygotes (which are fertile but grow very poorly). Reference: Kuwabara et al. (in prep.)
CB7587 C. elegans ptr-15(gk5234) V; crEx498. Show Description
crEx498 [dpy-14p::ptr-15(+) + sur-5p::GFP]. Pick animals with nuclear GFP throughout body to maintain. Lethal ptr-15 deletion allele marked with pharyngeal GFP [loxP ::myo-2p::GFP::unc-54 3’UTR + rps-27p::neoR::unc-54 3’UTR::loxP]; lethality rescued by hypodermal expression of PTR-15 form crEx498 array. Non-nuclear GFP animals (only pharyngeal expression) will be dead eggs and dead hatchlings. Derived from parental strain VC4151. References: O’Rourke et al. (in revision 2024).
RB1693 C. elegans ptr-10(ok2106) I. Show Description
F55F8.1. Homozygous. Outer Left Sequence: CTTTTTCCAGACGGAACGAC. Outer Right Sequence: ATCCGAGAACTCCCAAATCA. Inner Left Sequence: GTACGTGGTCTTTTGCCGAT. Inner Right Sequence: AGCAACCCAGAAAGAGCAAA. Inner Primer PCR Length: 3178 bp. Deletion Size: 1861 bp. Deletion left flank: AATAAAATGGATGAGTATAAGAAGCAAGCG. Deletion right flank: CAAGTTTCAGAGGAAATTCATAAAATTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2542 C. elegans ptr-18(ok3532) II. Show Description
Y38F1A.3 Homozygous. Outer Left Sequence: atttgccgaagttgcatagg. Outer Right Sequence: ttcacaaaatgcgaccatct. Inner Left Sequence: aaatcacatttttcggagctt. Inner Right Sequence: tgaagaattctggcaaatatcg. Inner Primer PCR Length: 1129. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3790 C. elegans F47D12.6(gk3750) III; ptr-16(gk3752) V; M163.11(gk3751) X. Show Description
Homozygous viable. Nonsense alleles and splicing defect allele identified by amplicon sequencing.
VC4125 C. elegans ptr-13(gk5205) II. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5205 mutation is C->T, flanking sequences CAGAGGATACGATAGATTGACCCCAGGCAT and CATTCGATTGCAAGTAGTTTCTAAACCAGT.
VC4151 C. elegans ptr-15(gk5234[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2870 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATGAGAGTGCATACGACCCAGAATACAAT. Right flanking sequence: CCTCGGTTCGCATATTCAGAATACCGAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4160 C. elegans ptr-13(gk5246[loxP + myo-2::GFPp::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 3626 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACGGGTACGACGAACAATGGGGCCATGC ; Right flanking sequence: TGACGGCAGGCAGACAGGCAGAACATGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4203 C. elegans ptr-19(gk5288[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 4684 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGGTGATCATCGAAGATAGAATATTGGGGA; Right flanking sequence: TAGTGATATTGGTAGACGAGGTCCTTACCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4226 C. elegans ptr-14(gk5312[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2729 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGCAGAAGACTGTGGCTAAATGTTTCTAAT; Right flanking sequence: CGCTATAGGATTTCCACTTTTACAATGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.