ABR212 |
C. elegans |
acd-1(sta6) delm-2(ok1822) I. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4).
|
|
ABR225 |
C. elegans |
acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.
|
|
AH159 |
C. elegans |
sra-13(zh13) II. Show Description
sra-13(zh13) mutants display stronger chemotaxis to limiting concentrations of isoamylalcohol and diacetyl than WT animals. Deletion allele. 396 bp of 5' promoter sequence and all but the last exon are removed; probably a null allele.
|
|
AQ351 |
C. elegans |
bus-8(lj22) X. Show Description
Skiddy, bleach-sensitive, drug-sensitive, Bus, resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. lj22 is a missense mutation (R32C) in out-of-frame 5'exon U1. Reference: Partridge et al. (2008) PMID: 18395708.
|
|
BR2815 |
C. elegans |
nep-1(by159) II. Show Description
1450 bp deletion. Deletion removes 245 bp of promoter, 1st exon and 2nd exon.
|
|
BW1563 |
C. elegans |
pal-1(ct281)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct281 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct281 is a 4.7kb deletion removing intron 5, exon 6, and the 3'UTR of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
|
|
BW1566 |
C. elegans |
pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
|
|
BW1927 |
C. elegans |
pal-1(ct224)/qC1 [dpy-19(e1259) glp-1(q339)] III; ctIs33. Show Description
ctIs33 [pal-1::GFP + rol-6(su1006)]. Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct224 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct224 is a 4.2kb deletion removing exon 1 through exon 6 of the pal-1 gene. ctIs33 carries a non-rescuing pal-1::GFP fusion containing ~7kb 5' of the SL1 splice site through part of exon 5 fused to GFP. GFP expression is primarily embryonic and limited to a few cells; not visible except at high magnification. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
|
|
CB4037 |
C. elegans |
glp-1(e2141) III. Show Description
Temperature sensitive. Sterile at 25C. Maintain at 15C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. [2/98: Craig Mello noticed a different embryonic phenotype in this strain as compared to the e2141 stock that Jim Priess obtained from England-the ABp fate appears WT.] [NOTE (11/16/10 - J. Hubbard): This strain is NOT synonymous with glp-1(e2144) as previously reported in Kodoyianni V, Maine EM, Kimble J. (1992) [Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans. Mol Biol Cell. 3,1199-213. PMID: 1457827]. As reported in Worm Breeders Gazette December 2010; 18(3), e2144 carries the mutation c2785t in exon 8, leading to the amino acid change L929F, whereas e2141 carries the mutations c2920t and a3610g in exon 8, leading to the amino acid changes R974C and T1204A.]
|
|
CB5414 |
C. elegans |
srd-1(eh1) II. Show Description
EMS-induced deletion from -583 to +1017, including first two exons and part of third exon. Probable null. No obvious phenotype.
|
|
CB7471 |
C. elegans |
unc-119(ed3) III; bus-8(lj22) X; eEx861. Show Description
eEx861 [bus-8(U1,2)::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. bus-8 exon U1 mutation rescued by small U1,2 transgene. Reference: O'Rourke et al (in preparation).
|
|
CER178 |
C. elegans |
nfki-1(cer1) X. Show Description
cer1 is a CRISPR-generated 368 bp deletion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
|
|
CER187 |
C. elegans |
nfki-1(cer2) X. Show Description
cer2 is a CRISPR-generated 438 bp deletion + 50 bp insertion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
|
|
CH1179 |
C. elegans |
unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;
|
|
CP99 |
C. briggsae |
Cbr-unc-119(nm67) III. Show Description
Derived from AF16. Outcrossed >6x to AF16. Unc, slightly Dpy, no dauer formation (similar to C. elegans unc-119). nm67 is a deletion (827 bp) in Cbr-119 begining in exon 1 and ending 3' of exon 4. Reference: Liu Q, et al. Development. 2012 Apr;139(8):1509-21.
|
|
CX2065 |
C. elegans |
odr-1(n1936) X. Show Description
Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.]
|
|
DG4153 |
C. elegans |
pod-2(tn1691) II; tnEx212. Show Description
tnEx212 [pod-2(+) + sur-5::GFP]. Pick GFP+ animals to maintain. sur-5::gfp(+) animals are wild type and segregate GFP(+) wild-type animals and GFP(-) pod-2(tn1691) dead embryos. tn1691 deletes ~15 kb within pod-2, including most of Exon 2 through to and including the stop codon (but not the polyA site). Reference: Starich TA, et al. eLife 2020;9:e58619 DOI: 10.7554/eLife.58619 PMID: 32735213
|
|
DG4329 |
C. elegans |
fasn-1(tn1762) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP heterozygotes, arrested hT2 aneuploids, and non-GFP tn1762 homozygotes (dead embryos and L1 larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. tn1762 is a ~9.2 kb deletion within fasn-1, including Exon 2 thru to 57 nt preceding stop codon. Reference: Starich TA, et al. eLife 2020;9:e58619 DOI: 10.7554/eLife.58619 PMID: 32735213
|
|
DR1942 |
C. elegans |
daf-2(e979) III. Show Description
This strain forms 20% dauers at 15C. At 25C there occurs about 25% embryonic arrest and about 75% L1 arrest. The e979 mutation results in an amino acid substitution, C146Y, in the ligand-binding domain of the DAF-2 receptor. [CGC received new stock of DR1942 September 2002. Previous stock was probably m41 and not e979.] [June 2004: Patrice Albert has confirmed the mutation in this stock: Repeat of sequencing for CGC collection strain DR1942 [daf-2(e979)] is complete. The strain does carry a C146Y mutation (coding strand TGC to TAC) [Mutation position is at 143, not 146, based on the amino acid sequence shown in Wormbase for daf-2. It's the C in partial sequence EKRCGPI of Exon 5.].]
|
|
EG9631 |
C. elegans |
unc-13(s69) I. Show Description
Aldicarb resistant. This allele is a small exonic deletion that frameshifts exon 21, thus deleting the MUN domain of both long and short isoforms of unc-13. The reference allele e51 is R471-stop, affecting only UNC-13L. Derived by 2x outcross of BC168. Reference: Rose AM & Baillie DL. Genetics. 1980 Nov;96(3):639-48.
|
|
ERC84 |
C. elegans |
top-1(ers56[top-1::degron::GFP]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Degron tag inserted at the end of exon five in the endogenous top-1 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
|
|
EU1383 |
C. elegans |
act-2(ok1229) V. Show Description
Strain is homozygous viable due to redundancy of act- and act-3 genes. AT 15C, all embyros produced by homozygous mothers hatch; at 26C, 88% of embryos hatch. Deletion which removes 544 nucleotides of act-2 plus the predicted 3' UTR and 705 nucleotides 3' of that. This removes 163/376 amino acids of the act-2 sequence (calculated with ATG methionine included). Sequence of deletion is (text inside of slashes is deleted, with 5' and 3' sequences shown): (exon#2)5'....gtgaaatcgtgcgtgacatc/aaggagaagctttgtt........ ...tggatagacattggtgt/gcgcactccttctggat.....3'(872 nucleotides from stop codon). Removes 489/1131 coding base pairs, beginning in second exn and extending beyond the 3' UTR.
|
|
EU1424 |
C. elegans |
mom-2(or77) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
mom-2(or77) is a recessive, non-conditional maternal-effect embryonic lethal. Weak allele of mom-2/Wnt (splice acceptor mutation in last exon (exon6). 8% of mutant embryos lack gut. Heterozygotes are Unc.
|
|
EU855 |
C. elegans |
mom-2(or309) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, WT which give only dead eggs, and dead eggs. or309 is a deletion allele: removes exon 4 to 3' end and leave about 100 N-terminal amino acids.
|
|
FF276 |
C. elegans |
dpy-17(e164) unc-32(f121) ncl-1(e1865)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes), and larval lethals (f121 homozygotes). g to a transition in exon 6 (2874), changing a Gly in Glu in ZK637.8 gene encoding a V-ATPase alpha subunit
|
|
FF451 |
C. elegans |
unc-32(f131) III. Show Description
Extreme coiler from L1 to adult. Hypomorph. f131/nDf17 is L1 lethal. Molecular lesion: g to a transition in splice donor site of exon 6 (g3485a) in ZK637.8 gene encoding a V-ATPase alpha subunit.
|
|
GE68 |
C. elegans |
glp-1(e2144) III. Show Description
Sterile at 25C, maintain at 15C. NOTE (11/16/10 - J. Hubbard): This strain is NOT synonymous with glp-1(e2141) as previously reported in Kodoyianni V, Maine EM, Kimble J. (1992) [Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans. Mol Biol Cell. 3,1199-213. PMID: 1457827]. As reported in WBG article by Dalfó D, Priess J, Schnabel R and Hubbard J. (2010) [glp-1(e2141) sequence correction. The Worm Breeders Gazette. 18-3.], e2144 carries the mutation c2785t in exon 8, leading to the amino acid change L929F, whereas e2141 carries the mutations c2920t and a3610g in exon 8, leading to the amino acid changes R974C and T1204A.
|
|
GJ443 |
C. elegans |
gjIs140. Show Description
gjIs140 [gpa-4::GFP + dpy-20(+)]. Reporter construct includes 2.5 kb upstream and the first exon of gpa-4 fused in frame with GFP. Reference: Burghoorn et al. Proc. Natl. Acad. Sci. USA 2007 Apr; 104(17):7157-62.
|
|
GLW53 |
C. elegans |
egl-19(utx45[egl-19(A&B)::mScarlet-I-C1::3xMyc] IV. Show Description
Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3 (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.
|
|
GR1309 |
C. elegans |
daf-16(mgDf47) I; daf-2(e1370) III. Show Description
mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4.
|
|
GR1333 |
C. elegans |
yzIs71 V. Show Description
yzIs71 [tph-1p::GFP + rol-6(su1006)] V. Rollers. tph-1 transcriptional reporter containing 3.1kb of tph-1 5 regulatory sequence through the beginning of exon 4. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Sze JY, et al. Nature. 2000 Feb 3;403(6769):560-4.
|
|
GR1373 |
C. elegans |
eri-1(mg366) IV. Show Description
Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366).
|
|
GS9801 |
C. elegans |
rde-1(ar660) V. Show Description
rde-1(ar660)[rde-1(flexon)]. 9th intron of rde-1 replaced with a flexon - an artificial exon flanked by artificial introns that each contain a lox2272 site (a flexon). Severely reduces rde-1 function, function can be restored upon excision of the flexon by Cre recombinase. Reference: Shaffer JM & Greenwald I. Proc Natl Acad Sci U S A. 2022 Jan 18;119(3):e2117451119. doi: 10.1073/pnas.2117451119. PMID: 35027456.
|
|
GWJ1 |
C. elegans |
lap-1(pk486). Show Description
1063 bp deletion in gene from nucleotide 489 (intron 1) to 1552 (exon 3). Phenotype: slow growth.
|
|
HBR762 |
C. elegans |
C10C6.7(goe3) IV. Show Description
goe3 is a 25 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.
|
|
HBR764 |
C. elegans |
C10C6.7(goe5) IV. Show Description
goe5 is a 4 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.
|
|
HX103 |
C. elegans |
chd-3(eh4) X. Show Description
T14G8.1 Deletion of 2018 bp of T14G8.1 [nucleotide 3699 (in exon 4) joined to 1682 (in exon 6)]. No phenotype observed.
|
|
IK589 |
C. elegans |
ttx-7(nj50) I. Show Description
Putative null allele which lacks whole of the first exon of the gene (lacking 361 bp area corresponding to 13460-13820 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of synaptic proteins is abnormal in RIA interneurons.
|
|
IK591 |
C. elegans |
ttx-7(nj51) I. Show Description
Putative null allele which lacks whole of the 3rd exon of the gene (lacking 260 bp area corresponding to 12984-13243 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of SNB-1::GFP is abnormal in RIA interneurons.
|
|
JH3180 |
C. elegans |
nos-2(ax2033) II. Show Description
Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
JK6383 |
C. elegans |
mpk-1(q1147[V5::mpk-1B] q1183[mpk-1AB::2xOLLAS]) III. Show Description
Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
|
|
JK6403 |
C. elegans |
mpk-1(q1147[V5::mpk-1B] q1201[mpk-1B del] q1183[mpk-1AB::2xOLLAS])/qC1 [qIs56] III. Show Description
qIs56 [lag-2p::GFP + unc-119(+)]. q1201 is a 125 bp deletion causing a frameshift in mpk-1B without affected mpk-1A. Heterozygous animals Roll and have GFP+ distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes (sterile, but form a vulva). qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
|
|
JMC101 |
C. elegans |
csr-1(tor67[gfp::3xflag::csr-1]) IV . Show Description
GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus; tags both isoforms. Reference: Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283
|
|
JMC151 |
C. elegans |
csr-1(tor160[csr-1 exon1::GFP::FLAG (IV:7957568)]) IV . Show Description
GFP and 3xFLAG tags inserted into first exon of endgonenous csr-1 locus (IV:7957568); specifically tags a-isoform.
|
|
JMC164 |
C. elegans |
csr-1(tor67[csr-1 exon2::GFP::FLAG IV:7958598]csr- 1(mg660[G120*]) IV) IV . Show Description
Null allele of csr-1 with GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus. tor67 would normally tag both long and short isoforms, but the mg660 allele introduces a stop codon into the first exon so the long isoform is not made and only tagged CSR-1B isoform is produced.
|
|
JN2411 |
C. elegans |
sinh-1(pe420) II. Show Description
Chemotaxis abnormality, developmental delay, small brood size. pe420 is a 22 bp deletion in exon 1.
|
|
JN2722 |
C. elegans |
daf-2(pe2722) III. Show Description
daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047
|
|
JU929 |
C. briggsae |
Cbr-dpy-18(mf104). Show Description
Mos1 insertion in CBG13195 = Cbr-dpy-18 in exon before TATgtgagtcgatttgtttgatcgg. Dpy phenotype.
|
|
KM137 |
C. elegans |
mef-2(gv2) I. Show Description
760 bp deletion beginnin in exon 3 and ending in exon 4. No strong visible phenotype.
|
|
KX10 |
C. elegans |
ife-3(ok191)/unc-34(e566) V. Show Description
At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.
|
|