More Fields
Strain Species Genotype
BC1519 C. elegans dpy-18(e364)/eT1 III; sDf31/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. Original isolation: BO strain BC1261 unc-22(s727) hermaphrodite heat shocked for 1 hour at 34C. Crossed to N2 strain BC1270 unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Picked individual WT hermaphrodites. Screened for the absence of gravid Unc-22. Retained strain as BC1379. Balanced over eT1: BC1379 unc-22(s727)[BO]/nT1[N2] IV; sDf31[BO]/nT1[N2] hermaphrodite crossed to BC 1265 dpy-18(e364)/eT1 III; unc-46(e177)/eT1 V. Pick WT hermaphrodites that twitch in 1% nicotine. Retained one strain that segregated Unc-36 as BC1428. Pseudolinked sDf31 to dpy-18: BC1428 +/eT1 III; sDf31[BO]/eT1 V crossed to BC 1265 dpy-18/eT1 III; unc-46/eT1 V male. Picked WT hermaphrodite F1. From strains segregating Unc-36 but no Dpy or Unc-46 or DpyUnc-46, cross WT hermaphrodites to BC1265 males. From strains producing Dpy, crossed individual WT males to BC70 eT1;eT1. From each cross, crossed WT X WT. Kept one strain producing on Dpy or DpyUncs as S-H716 male. Picked one hermaphrodite to start BC1519. Comments: 1) The LGV region balanced by eT1 should be all BO. 2) Probably the rest of the genome still has a considerable amount from BO since it was crossed to N2 only 4 times. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BN1082 C. elegans f="/strain/search?st1=npp-2&sf1=all">npp-2(f="/strain/search?st1=bq38&sf1=all">bq38 [f="/strain/search?st1=g&sf1=all">g>f>p::f="/strain/search?st1=npp-2&sf1=all">npp-2]) I; bqSi189 II. Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous npp-2 inserted by CRISPR/Cas9 after the npp-2 start codon. FRT sites in GFP introns 2 & 3 are indicated by ">" symbols in genotype. Ubiquitous expression of mCh::HIS-58. Might carry unc-119(ed3) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi:
BN1216 C. elegans baf-1(bq52[gf>p::baf-1>]) III; bqSi577 IV. Show Description
bqSi577 [myo-2p::GFP + unc-119(+)] IV. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous baf-1 inserted by CRISPR/Cas9 after the baf-1 start codon. FRT sites in GFP intron 3 and baf-1 3'UTR are indicated by ">" symbols in genotype. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi:
BN580 C. elegans f="/strain/search?st1=baf-1&sf1=all">baf-1(f="/strain/search?st1=bq12&sf1=all">bq12[f="/strain/search?st1=g&sf1=all">g>f>p::f="/strain/search?st1=baf-1&sf1=all">baf-1]) III. Show Description
GFP cassette for labeling and FLP-mediated inactivation of baf-1 inserted by CRISPR/Cas9 after the baf-1 start codon. ">" symbols in genotype indicate Frt sites in introns 2 and 3 of GFP.
BN581 C. elegans baf-1(bq13[mCherry::baf-1]) III. Show Description
mCherry tag inserted into endogenous baf-1 locus after the start codon using by CRISPR/Cas9 engineering. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi:
BN793 C. elegans f="/strain/search?st1=bqSi189&sf1=all">bqSi189 II; f="/strain/search?st1=mel-28&sf1=all">mel-28(f="/strain/search?st1=bq17&sf1=all">bq17 [f="/strain/search?st1=g&sf1=all">g>f>p::f="/strain/search?st1=mel-28&sf1=all">mel-28]) III. Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous mel-28 inserted by CRISPR/Cas9 after the mel-28 start codon. FRT sites in GFP introns 2 & 3 are indicated by ">" symbols in genotype. Ubiquitous expression of mCherry::HIS-58. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi:
BS3727 C. elegans lip-1(ok154) IV. Show Description
Temperature-sensitive allele. Can be grown at 20C with reduced fertility. Defects in pachytene progression, small oocyte formation and Emo are highly penetrant at 25C. ok154 is a null allele; 1504 bp deletion from -156 bp to +1348 bp, removes the start codon. Reference: Proc Natl Acad Sci USA. Das D, et al. 2022 Jan 18;119(3):e2113649119. PMID: 35022236
CER244 C. elegans ikb-1(cer9) I. Show Description
cer9 is a CRISPR-generated 462 bp deletion at the beginning of the ikb-1 coding sequence, including the start codon (no transcript should be synthesized). Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
CER323 C. elegans ubh-4(cer27) II. Show Description
Reduced brood size. Genetic interaction with rpn-9. cer27 is a 1033 bp deletion removing the start codon and nearly all of the ubh-4 coding sequence. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
CV385 C. elegans acer-1(rj15) II. Show Description
acer-1(rj15) is a 7 nt deletion (removes nt 35-41 from the start codon) resulting in an out-of-frame deletion. Increased histone acetylation. Reference: Gao J, et al., PLoS Genet. 2015 Mar 13;11(3):e1005029.
DWP219 C. elegans daam-1(ups39) V. Show Description
Superficially wild-type. ups39 is a CRISPR-engineered deletion within daam-1. daam-1(ups39) encodes an in-frame stop codon near the start of its FH2-coding sequence, and a 1-nt frame shift due to the LoxP site, and is thus predicted encode a non-functional formin. Reference: Sundaramurthy S, et al. Cytoskeleton (Hoboken). 2020 Oct;77(10):422-441. doi: 10.1002/cm.21639. PMID: 33103378.
HBR2025 C. elegans unc-119(ed3) III; goeEx711. Show Description
goeEx711 [nlp-42p::mGFP::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Construct contains 2000 bp of nlp-42 promoter upstream of start. Expression pattern is variable between worms.
HZ946 C. elegans rpl-43(bp399) II; bpIs151. Show Description
bpIs151 [sqst-1p::sqst-1::GFP + unc-76(+)]. bp399 mutants accumulate SQST-1 aggregates strictly in the intestine in a distinct temporal pattern. SQST-1::GFP aggregates are absent in bp399 embryos, but start to form in L1 larvae and increase in number and size throughout larval development. Reference: Guo B, et al. EMBO Rep. 2014 Jun;15(6):705-13.
IX4506 C elegans mls-2(vy248[mNG::mls-2]) X. Show Description
mNG tag inserted into endogenous mls-2 locus after the start codon using CRISPR/Cas9 engineering, producing a translational mNG::MLS-2 reporter protein. Derived by SEC excision of mls-2(vy247[mNG::SEC::mls-2 knock-in]) in parental strain. mNG::MLS-2 is detected in the nucleus of a few cells in embryos, and localizes to the nucleus of a subset of head cells and the M mesoblast in larvae and adults. Reference: Xiong R., et al. (2022). mNG-tagged mls-2 knock-in alleles in C. elegans. microPublication Biology. 10.17912/micropub.biology.000529.
JH3248 C. elegans meg-4(ax2081) X. Show Description
Deletion removing 733 base pairs upstream of start and the first 2565 bases of the endogenous meg-4 locus. Reference: Wang JT, et al. eLife 2014;3:e04591.
JK3221 C. elegans sys-1(q736) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT, but frequently sterile when balanced by hT2[qIs48]. q736 is homozygous embryonic lethal. (Approx. 5% of hets are Sterile when balanced by WT.) hT2[qIs48] homozygotes are inviable. q736 is a deletion of sys-1 deleting from nucleotide 1803 to nucleotide 3992 of the genomic sequence (a of start atg is position 1). Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK4842 C. elegans qSi29 II; unc-119(ed3) III. Show Description
qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK5072 C. elegans qSi29 II; unc-119(ed3) III; teIs1 IV. Show Description
qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. teIs1 [oma-1::GFP + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. oma-1::GFP expression in oocyte cytoplasm. teIs1 rescues GFP expression in silenced germline trangenes more effectively at 25C. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK5596 C. elegans lst-1(q867) I. Show Description
CRIPSR-engineered mutation of the lst-1M71 longform start codon (ATG to AT, deletion of G). Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205
JK5796 C. elegans lst-1(q869) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 homozygotes (viable and somewhat fertile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. q869 is a deletion of the entire lst-1 coding sequence as well as 139 bp upstream of M71 start codon and 228 bp downstream of the coding sequence. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205
JK6673 C. elegans fzr-1(q1290[3xV5::fzr-1]) II. Show Description
Endogenous fzr-1 locus tagged with 3xV5 close to the N-terminus. Insertion site is a few amino acids downstream of start site (...PAN-3xV5-SPA…). Primer sequences to validate the strain: slc316 GCTTTTGCGTGTTCTCCTCA, slc317 TGAATCCTGAGTCATCATCCGAGT, WT product 347 bp, q1290[3xV5::fzr-1] product 485 bp.
KX17 C. elegans ife-4(ok320) X. Show Description
C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4).
LX533 C. elegans rgs-6(vs62) X. Show Description
Deletion removes 1465 bp. Removes start site and majority of RGS domain. Has beginning and end sequences AAAAAGATCGAATATCGGTTGT...TATGACGTAGCACAATATCAGG.
LX733 C. elegans rgs-10&rgs-11(vs110) X. Show Description
This deletion removes sequence 5' to start of rgs-10 and may therefore remove promoter sequence for rgs-10&rgs-11.
MT13650 C. elegans mir-48(n4097) V. Show Description
Worms are weakly retarded, with cold-sensitive supernumerary adult-stage molt phenotype (<5% at 20C, about 70% at 15C). 293 bp deletion encompassing the mir-48 gene. mir-48 is at 5908 to 5885 of F56A12. Deletion goes from -45 to +248 from start of mir-48.
MT13971 C. elegans hpl-1(n4317) X. Show Description
Deletion removes the first exon with the start codon and nearly all of the exonic sequence except the last exon.
OH11674 C. elegans otIs437 V. Show Description
otIs437 [unc-3p::rab-3::GFP + ttx-3p::mCherry] V. Reporter contains 558bp upstream of unc-3 start site; marks presynapses of DA/DB class motor neurons innervating muscle and VD motor neurons in dorsal nerve cord. Reference: Kratsios P, et al. Curr Biol. 2015 May 18;25(10):1282-95.
OH12531 C. elegans otIs527. Show Description
otIs527 [nlr-1p::GFP::unc-54 3'UTR + pha-1(+)]. Reporter contains 150bp upstream of the nlr-1 start codon. Derived from injection of pMG144; line 4-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13333 C. elegans him-5(e1490) V; otIs514. Show Description
otIs514 [unc-25p::unc-25(partial)::GFP::unc-54 3'UTR + pha-1(+)]. Him. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 6. Derived from injection of pMG89; line 14-12. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13476 C. elegans tab-1(ot796) II; otIs549 X. Show Description
otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. Derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13526 C. elegans him-5(e1490) V; otIs549 X. Show Description
otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. Him. Reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. Derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13830 C. elegans sax-7(ot820) IV; oyIs14 V. Show Description
oyIs14 [sra-6::GFP + lin-15(+)] V. ot820 is an 8bp deletion 15bp from the start of the sax-7S start codon, resulting in a frameshift and sax-7S isoform-specific null allele.
OH14405 C. elegans tab-1(gk753) II; otIs549 X; otEx6747. Show Description
otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6747 [tab-1(fosmid)::SL2::YFP::H2B + rol-1(su1006)]. Pick Rollers to maintain otEx6747. Him. otIs549 reporter contains 1.8 kb upstream of the unc-25 start codon through exon 4. otIs549 was derived from injection of pMG154; line 2-1. otEx6747 reporter tag inserted into fosmid WRM0617bA03; line 5-4. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14548 C. elegans tab-1(gk753) II; otIs549 X; otEx6804. Show Description
otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)] X. otEx6804 [tab-1(+) + ttx-3::GFP]. Maintain otEx6804 by picking ttx-3::GFP. otEx6804 carries a PCR fragment containing the tab-1 locus; rescues gk753. otIs549 contains 1.8 kb upstream of the unc-25 start codon through exon 4; derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14619 C. elegans elt-1(ok1002) IV; him-5(e1490) V; otIs549 X; otEx6751. Show Description
otIs549 [unc-25p::unc-25(partial)::mChopti::unc-54 3'UTR + pha-1(+)]. otEx6751 [unc-47p::GFP + elt-1(+)(fosmid)]. Him. otEx6751 rescues lethal elt-1 mutation; contains fosmid WRM0619bE05. otIs549 contains 1.8 kb upstream of the unc-25 start codon through exon 4; derived from injection of pMG154; line 2-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14674 C. elegans otIs348 IV; him-5(e1490) V. Show Description
otIs348 [unc-47p::mChopti::unc-54 3'UTR + pha-1(+)] IV. Him. otIs348 contains 300 bp upstream of the unc-47 start codon; derived from injection of pMG92; line 2-16. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14675 C. elegans otIs575 I; him-5(e1490) V. Show Description
otIs575 [unc-46p::GFP + pha-1(+)] I. Him. otIs575 contains 234 bp upstream of the unc-46 start codon; derived from injection of pMG117; line 17-2. Integrated in LG I near ceh-8 and ceh-12. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14711 C. elegans nhr-67(ot795) IV; him-5(e1490) V; otEx5999. Show Description
otEx5999 [nhr-67(fosmid) + unc-47p::mChopti]. Him. ot795 is lethal after L1 stage; all animals L2 and older should carry the extra-chromosomal array. otEx5999 carries fosmid WRM0613bE08; reporter contains 300 bp upstream of the unc-47 start codon. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH14712 C. elegans nhr-67(ot795) IV; him-5(e1490) V; otEx6001. Show Description
otEx6001 [nhr-67(fosmid) + unc-47p::GFP]. Him. ot795 is lethal after L1 stage; all animals L2 and older should carry the extra-chromosomal array. otEx6001 carries fosmid WRM0613bE08; reporter contains 300 bp upstream of the unc-47 start codon. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH15144 C. elegans pha-1(e2123) III; otEx7036. Show Description
otEx7036 [pals-22p::GFP::unc-54 3'UTR + pha-1(+)]. Transcriptional reporter containing pals-22 promoter (coordinates -791 to -1 from start). Maintain at 25C to select for otEx7036. Reference: Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15145 C. elegans pha-1(e2123) III; otEx7037. Show Description
otEx7037 [pals-22p::GFP::unc-54 3'UTR + pha-1(+)]. Translational reporter fusion containing pals-22 promoter (coordinates -791 to -1 from start). Maintain at 25C to select for otEx7037. Reference: Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15422 C. elegans ceh-14(ot900) X. Show Description
Null allele generated by gRNAs targeted to the first and last exons of ceh-14, resulting in a 4061bp deletion from +35 to +4098 relative to the start of the ORF.
OH15908 C. elegans him-5(e1490) V; dmd-4(ot957ot935) X. Show Description
CRISPR-engineered deletion in dmd-4(ot935[dmd-4::GFP]) removing +3201 to +3710 relative to start codon. Partial removal of intron 3 results in loss of somatic nervous system expression without affecting pharyngeal expression.
OH17241 C elegans unc-86(ot1158) III. Show Description
unc-86(ot1158) is a CRISPR-engineered null allele removing the entire unc-86 coding region. Very slightly Unc. The repair ssODN is TCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGTTTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). References: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi:
OH17513 C. elegans unc-86(ot1184) III; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. Show Description
Null allele of unc-86 generated by gRNAs targeted to the first and last exons, resulting in a 3202 bp deletion from -8 to +3194 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH17514 C. elegans ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V; ceh-14(ot1185) X. Show Description
Null allele of ceh-14 generated by gRNAs targeted to the first and last exons, resulting in a 4056 bp deletion from +40 to +4096 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH17515 C. elegans unc-30(ot1186) IV; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. Show Description
Null allele of unc-30 generated by gRNAs targeted to the first and last exons, resulting in a 5168 bp deletion from -37 to +5131 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
PS3818 C. elegans unc-68(r1158) him-5(e1490) V; syEx475. Show Description
syEx475 [myo-3p::unc-68(see following comments) + myo-2p::GFP + pUC-19]. Pick GFP+ animals to maintain. myo-3p::unc-68 transgene was produced by injecting pEM23 (myo-3 promoter + unc-68 exons 1-8) + 18 kb unc-86 PCR fragment (start codon through nucleotide 18090) + pLM511 (unc-68 position 11989 to the end); fragments were recombined in vivo.
PS4441 C. elegans syIs118 I; unc-119(ed4) III. Show Description
syIs118 [fos-1a::YFP-TX + unc-119(+)]. YFP inserted into Sal site seven amino acids down stream of start ATG of Cel-fos-L transcript. YFP from plasmid PPD136.64 (Andy Fire's 1999 kit). Promoter is from nucleotide 529 to 8110 of cosmid F29G9. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS6058 C. elegans pha-1(e2123) III; him-5(e1490) V; syEx1147. Show Description
syEx1147 [des-2::DES-2::GFP + pha-1(+) + pBluescript KS(+)]. Maintain at 25C to select for presence of transgene. GFP reporter is driven by the promoter of the des-2/des-3 operon and is expressed in ALA, RID, PVD, FLP, IL2, PLM, PVC, and M1 muscles of the pharynx. This construct contains 3.4 kb of sequence upstream of the des-2 start ATG (Treinin et al., 1998) (Van Buskirk and Sternberg, 2010).