Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
AGD383 C. elegans uthIs202. Show Description
uthIs202 [aak-2(intron 1)::aak-2(aa1-aa321)::Tomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.
AGD467 C. elegans uthEx490. Show Description
uthEx490 [aak-2 (intron 1)::aak-2(aa1-aa321 T172D)::GFP + crtc-1p::crtc-1::tdTomato + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.
AGD469 C. elegans uthEx492. Show Description
uthEx492 [aak-2 (intron 1)::aak-2(aa1-aa321 T172A)::GFP + crtc-1p::crtc-1::tdTomato + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.
AML344 C. elegans juSi164 unc-119(ed3) III; wtfIs263. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs263 [rab-3p::AI::ChR2(H134R)::unc-54 3'UTR + rab-3p::AI::Voltron::unc-54 3'UTR + rab-3p::his-24::tagBFP::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of ChR2 (H134R) along with Voltron volatage indicator and nuclear-localized tagBFP. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML376 C. elegans juSi164 unc-119(ed3) III; wtfEx296. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx296 [rab-3p::AI::gur-3G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Pick RFP+ to maintain. Keep plates covered to avoid unnecessary exposure to light. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML405 C. elegans juSi164 unc-119(ed3) III; wtfEx315. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx315 [5xQUAS::(delta)pes-10P::AI::gur-3G::unc-54 3'UTR + 5xQUAS::(delta)pes-10P::AI::prdx-2G::unc-54 3'UTR + rab-3p::AI::QF+hGR::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML438 C. elegans juSi164 unc-119(ed3) III; wtfIs335. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs335 [5xQUAS+(delta)pes-10p::AI::eTsChR::unc-54 3'UTR + rab-3p::AI::QF+hGR::SL2::tagBFP::unc-54 3'UTR + rab-3p::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal eTsChR on activation using dex treatment via QF+hGR. Worms also express calcium sensing fluorescence protein- GCaMP6s in nuclei of each neurons. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML535 C. elegans wtfEx478. Show Description
wtfEx478 [rab-3p::AI::lite-1G::SL2::tagBFP::unc-54 3'UTR + unc-122p::GFP]. Pick GFP+ animals to maintain. Worms express purple/violet light-sensitive optogenetic protein LITE-1 pan-neuronallly and nuclear-localized blue fluorescent protein tagBFP via SL2 trans-slpicing regulatory sequence. Worms also express GFP in coelomocytes. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML540 C. elegans juSi164 unc-119(ed3) III; wtfIs483. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs483 [rab-3p::AI::lite-1G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of a purple/violet light-sensitive optogenetic protein system LITE-1 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622.
AML614 C. elegans lgc-47(sy1501) X; wtfIs46; wtfEx535. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx535 [tdc-1p::AI::lgc- 47::SL2::his-24::tagRFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in RIML/R neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML617 C. elegans lgc-47(sy1501) X; wtfIs46; wtfEx538. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx538 [npr-9p::AI::lgc-47::SL2::tagBFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML618 C. elegans lgc-47(sy1501) X; wtfIs46; wtfEx539. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx539 [rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AVA neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AML622 C. elegans lgc-47(sy1501) X; wtfIs46; wtfEx543. Show Description
wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx543 [tdc-1p::AI::lgc-47::SL2::his-24::tagRFP + npr-9p::AI::lgc-47::SL2::tagBFP + rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB, AVA, and RIM neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821.
AUM2071 C. elegans vizSi32 II; unc-119(ed3) III. Show Description
vizSi32 [cdk-2p(intron)::GFP::tbb-2 3’ UTR + unc-119(+)] II. vizSi32 was inserted into ttTi5605 on Chr II using MosSci. Intron 1 of cdk-2 drives drives GFP expression in this transgene. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
BN1024 C. elegans emr-1(bq34[emr-1::mCherry]) I. Show Description
mCherry tag inserted at C-terminus of endogenous emr-1 locus using CRISPR/Cas9 contains FRT sites in 1st intron of emr-1 and 1st intron of mCherry to enable FLP-mediated conditional gene knockout. Reference: Romero-Bueno R, et al. EMBO J. 43(22): 5718-5746. doi: 10.1038/s44318-024-00261-8. PMID: 39367234.
BN1216 C. elegans baf-1(bq52[gf>p::baf-1>]) III; bqSi577 IV. Show Description
bqSi577 [myo-2p::GFP + unc-119(+)] IV. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous baf-1 inserted by CRISPR/Cas9 after the baf-1 start codon. FRT sites in GFP intron 3 and baf-1 3'UTR are indicated by ">" symbols in genotype. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
BU7222 C. elegans pat-3(st564) III; kqEx73. Show Description
kqEx73 [pat-3(sp) + rab-3::RFP + cki-1::GFP]. Pick RFP+ to maintain. kqEx73 carries a form of pat-3 gene with splicing defects; rescues pat-3 null allele. pat-3(sp) is a frameshift mutation in the splice acceptor region (ag to aa) that abolishes conserved interaction domains such as the NPxY motifs and creates a splice variant with an extra 19 amino acids. The pat-3(sp) animals not only produce mutant pat-3, but also express the regular splice form due to utilization of an unusual splice acceptor. Abnormal Distal Tip Cell migration and pat-3 gene splicing (intron 7) defects. Reference: Kihira S, et al. PLoS One. 2012;7(8):e42425.
BW1563 C. elegans pal-1(ct281)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Pick wild-type heterozygotes to maintain. ct281 homozygotes show Nob phenotype: approximately 80% of homozygous embryos arrest at about the time of hatching with fairly normal anterior development but a severely deformed posterior with a variable knob-like shape; approximately 20% fail to enclose and do not hatch. ct281 is a 4.7kb deletion removing intron 5, exon 6, and the 3'UTR of the pal-1 gene. Reference: Edgar LG, et al. Dev Biol. 2001 Jan 1;229(1):71-88.
CER178 C. elegans nfki-1(cer1) X. Show Description
cer1 is a CRISPR-generated 368 bp deletion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
CER187 C. elegans nfki-1(cer2) X. Show Description
cer2 is a CRISPR-generated 438 bp deletion + 50 bp insertion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
CFJ302 C. elegans unc-119(kst33) III. Show Description
Maintain at 15C. Temperature-sensitive unc-119 allele. Wild-type at 15C, intermediate Unc and Egl at 20C, and fully penetrant Unc and Egl at 25C. For use in transgenesis, maintain the strain at lower temperatures for increased brood size and easier injection, then transfer animals to 25C to select for transgenic animals based on Unc rescue. Molecular characterization shows a complex allele with a 210 bp duplication from a nearby exon-intron junction, which introduces 12 amino acids and a putative splice donor at a consensus splice acceptor site. The phenotype is most likely caused by temperature-sensitive splicing defects based on RT-PCR. Reference: Aljohani M, et al. Arrayed oligo libraries: genome-wide DNA- and RNP-based platforms for templated and non-templated CRISPR-Cas9 editing in C. elegans. (Submitted)
CH1179 C. elegans unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;
CX652 C. elegans kyIs235 V; syg-1(ky652) X. Show Description
kyIs235 [unc-86::snb-1::YFP + unc-4p::lin-10::RFP(intron) + odr-1::RFP]. Also known as unc-86::VAMP::YFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
FT1523 C. elegans sec-5(xn51[sec-5::ZF1::YFP + LoxP::unc-119::LoxP]) II; unc-119(ed3) III. Show Description
sec-5(xn51 [sec-5::ZF1::YFP + LoxP::unc-119::LoxP]) II. Knock-in of ZF1::YFP and unc-119(+) into the sec-5 locus, so that endogenous sec-5 protein is subject to ZIF-dependent degradation. Expresses SEC-5::ZF1::YFP maternally and zygotically. Expression in many cells, including early embryos, epithelial cells, excretory cell, and germ line. unc-119 is present in reverse orientation within an intron of YFP. Reference: Armenti ST et al. Development. 2014 Dec;141(23):4640-7. doi: 10.1242/dev.115048. Epub 2014 Nov 5. PMID: 25377555.
GS10037 C. elegans arSi159 [rps-27p::GFP(flexon)::H2B::unc-54 3'UTR + Cbr-unc-119(+)] II; unc-119(ed3) III. Show Description
arSi159 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 (II). The first intron of GFP was replaced with a Flexon containing two loxP sites. High level GFP::H2B expression requires Cre expression from a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GS9402 C. elegans arTi362 Show Description
arTi362 [rps-27p::TIR1(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (-19.98). The first intron of TIR1 was replaced with a Flexon containing two lox2272 sites. TIR1 is expressed at a high level in lineages where Cre is expressed. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GS9407 C. elegans arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I (-12.74). First intron of GFP is replaced with a Flexon containing two lox2272 sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Transgene maps to -12.74 (I). Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology.
GS9801 C. elegans rde-1(ar660) V. Show Description
rde-1(ar660)[rde-1(lox2272-flexon-lox2272)]. 9th intron of rde-1 replaced with a flexon - an artificial exon flanked by artificial introns that each contain a lox2272 site (a flexon). Severely reduces rde-1 function, function can be restored upon excision of the flexon by Cre recombinase. Reference: Shaffer JM & Greenwald I. Proc Natl Acad Sci U S A. 2022 Jan 18;119(3):e2117451119. doi: 10.1073/pnas.2117451119. PMID: 35027456.
GS9820 C. elegans arTi443 Show Description
arTi443 [rps-27p::TIR1(F79G)(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (+21.99). The first intron of TIR1(F79G) was replaced with a Flexon containing two lox2272 sites. TIR1(F79G) is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GS9847 C. elegans arTi452 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi452 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + NeoR] I (-4.81). First intron of GFP is replaced with a Flexon containing two loxP sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GS9922 C. elegans arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I (-3.80). The first intron of GFP was replaced with a Flexon containing two FRT sites. GFP::H2B is expressed at a high level in lineages where Flp recombiase is expressed with a second transgene. Flexon contains two FRT sites. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GWJ1 C. elegans lap-1(pk486). Show Description
1063 bp deletion in gene from nucleotide 489 (intron 1) to 1552 (exon 3). Phenotype: slow growth.
JDW101 C. elegans spe-44(wrd20[spe-44::mScarlet::3xMyc]) IV. Show Description
mScarlet::3xMyc tag inserted at the C-terminus of the endogenous spe-44 locus by CRISPR. Allele obtained using the self-excising cassette, following Dickinson et al, 2015 method. SEC was excised; there is a lox511I in the synthetic intron left by the excision. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.
JDW120 C. elegans spe-44(wrd32[spe-44::mScarlet::TEV::AID*::3xFLAG]) IV. Show Description
mScarlet::TEV::AID*::3xFLAG tag inserted at the C-terminus of the endogenous spe-44 locus by CRISPR. Insertion includes a flexible 30 amino acid linker between SPE-44 and mScarlet and was produced by SEC excision. Strain contains a lox511I site in a synthetic intron. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.
JH1463 C. elegans nos-2(ok230) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. The nos-2(ok230) allele is due to deletion of bases 30999 to 33076 of cosmid ZK1127 (GenBank accession U58758) and also deletes a portion of the him-14 gene (him-14 is in an intron of nos-2).
JT11069 C. elegans xbx-1(ok279) V. Show Description
Dyf. Osm. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).
KG4731 C. elegans unc-116(ce815[LoxP+sup-1(e995)+LoxP]) III. Show Description
Lox P sites in 3' UTR and 4th intron flank kinesin motor domain sequences; sup-1(e995) mini-gene inserted in second intron. Appears wild-type on plates and in quantitative locomotion assays. Can be used to conditionally delete gene sequences encoding the conventional kinesin motor domain in a tissue specific manner by driving expression of Cre recombinase in the tissue of interest. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.
KG5148 C. elegans unc-104(ce833[5xMyc::AID*::unc-104+sup-1(e995)]) II. Show Description
The Auxin Inducible Degron (AID*) flanked by a 5X Myc/spacer tag on left and a single spacer on the right is fused to the N-terminus of the unc-104 gene. Allows conditional degradation of UNC-104 protein when combined with tissue specific expression of TIR1 in the presence of 1 mM Auxin in plate media. Note: KG5148 does not express TIR1. On standard plates: wild type growth, appearance, and locomotion rate. For animals expressing a TIR1 transgene in the nervous system: Animals that hatch and develop on 1 mM Auxin plates generally remain tightly coiled near the location of hatching and exhibit slow growth (up to 7 days to reach adulthood, with 98% reaching adulthood by 7 days). Adults placed on Auxin abruptly lose about 75% of their locomotion function between 6 and 12 hours after plating. The remaining locomotion function is lost gradually between 12 and 52 hours. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.
KM134 C. elegans mef-2(gv1) I; ayIs. Show Description
Slightly short and fat as adults. 1376 bp deletion of part of intron 1 through intron 4. Contains an integrated hlh-8::GFP reporter marking the postembryonic M lineage.
KM48 C. elegans +/szT1 [lon-2(e678)] I; cdk-4(gv3)/szT1 X. Show Description
745 bp deletion of cdk-4 from intron I to exon3 removing putative ATP binding domain and catalytic residues. Most homozygous animals arrest at L2 due to absence of most or all postembryonic somatic cell divisions. Some germline proliferation resulting in slightly elongated gonad.
KRA102 C. elegans lin-39(kas1) III; ynIs40 V; unc-3(n3435) X. Show Description
ynIs40 [flp-11p::GFP] V. kas1 is a point mutation in the second intron splice acceptor site, disrupting splicing. Worms are vulvaless and have severe locomotion defects. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
LIU86 C. elegans dhs-28(ldr4) X; ldrIs1; ldrIs2. Show Description
ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. ldrIs2 [mdt-28p::mdt-28::mCherry + unc-76(+)]. ldr4 is a G-to-A mutation in the splice donor site of Intron 1. Super-sized lipid droplets. [NOTE: The positions indicated in the original Figure 1C of Xie, et al. (2019) are based on an incorrect sequence map and do not reflect the position of the affected amino acid or position in a spliced transcript. The G-to-A mutation in the splice donor site is correct and has been independently confirmed by sequence analysis in another lab.] Reference: Xie K, et al. Sci Rep. 2019 Oct 17;9(1):14902. doi: 10.1038/s41598-019-51399-z. PMID: 31624276
LP316 C. elegans hmp-2(cp78[GFP::hmp-2a + LoxP]) III. Show Description
cp78[gfp::hmp-2 + LoxP] III. GFP inserted at the N terminus of endogenous hmp-2 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar in the second synthetic intron of GFP. Green fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
MCJ366 C. elegans mir-4812(cdb175) mir-1829b(cdb163) mir-1829c(cdb164) mir-1829a(cbd199) X. Show Description
Deletion allele of each microRNA. For mir-1829a, the entire intron is deleted to minimize disruption of host gene, gas-1. sgRNA #1: CGAGGACTGAAGGAGGAACG; sgRNA #2: GGAGGCGGAAGCTACCTGCG; sgRNA #3: GCGGTAACAGAGAGAACATG; sgRNA #4: GCTTCCTCGTCCTGCCGCCG; sgRNA #5: GTTTTCAAAACAGGGGGAGG; sgRNA #6: GCGACAGCAGAAAGAGCATG; sgRNA #7: GACGCAACCACTTTGGCCAC; sgRNA #8: ACGTGAGCTCTATAACTAAC; sgRNA #9: ATGGAACCGGAAAACCATAT; sgRNA #10: AGTGAGCAAACCCTGGAGCG; sgRNA #11: GCTACCATAGGCACCACGAG. Guide RNAs were injected in three rounds of CRISPR. sgRNAs #7-8 did not result in edits at the mir-1829a locus. sgRNA #11 was for co-CRISPR to mark jackpot founder plates.Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526.
NL1106 C. elegans prk-2(pk278) III. Show Description
Deletion between: (exon 2): CCCAGAAGGCTT and (intron 4): ATATATATATATAGAC (complex rearrangement in between).
OE3002 C. elegans him-8(e1489) IV; xbx-1(ok279) V. Show Description
Dyf. Osm. Throws males. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).
OH15908 C. elegans him-5(e1490) V; dmd-4(ot957ot935) X. Show Description
CRISPR-engineered deletion in dmd-4(ot935[dmd-4::GFP]) removing +3201 to +3710 relative to start codon. Partial removal of intron 3 results in loss of somatic nervous system expression without affecting pharyngeal expression.
OH18203 C. elegans ceh-44(ot1294[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
OH18268 C. elegans ceh-44(ot1402[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1402 is a deletion removing the UNC-75 binding site within intron 7 of the endogenously-tagged ceh-44 locus. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
OH18410 C. elegans cone-1(syb5437[GFP::cone-1]) ceh-44(ot1294[*ot1015[ceh-44::GFP]]) III. Show Description
GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. Normally broad, punctate expression of GFP::CEH-44 is not present. Please contact Oliver Hobert prior to publishing work using this strain.