Search Strains

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7181 and CGC66. hd7181 is a 1382 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACTTCCTGCACCCAGAACTCATCAATTCCA; Right flanking sequence: AGCCATGCTAGAATTTCCTTTGGGTCCCCA. sgRNA #1: TCACTACTATTTACTCCACG; sgRNA #2: GGAAGTCTTGCATTAGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ homozygotes and paralysed DpyUnc mKate2+ mnC1 homozygotes. Derived from parental strains VH7182 and CGC48. hd7182 is a 1757 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCACAACTCTGTGGAATATCCATTTCAC; Right flanking sequence: ATAGCTTCTTCGCTTATTTTTCCAGACATC. sgRNA #1: ACGCTCGAATCGCAAACTGG; sgRNA #2: GCAGGAACAGGCCGAAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4597 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGCACCTGTCACTTGACACTCCTTTGTCCA; Right flanking sequence: TTTAAGCCTCAAAATTGTCATGCTAAAAAA. sgRNA #1: CTGGGAAGTGAGCAGTCTAC; sgRNA #2: CCGGGATAAGAAGGTACGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 952 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAATCGCCCAAATTCCAAAAATTATGCCA; Right flanking sequence: AGGAGAGCAGCTCGGGTGTACGCTGTAGCT. sgRNA #1: ATTGTGGTTGCTACTCTTTT; sgRNA #2: AGGCAAGAAATCTTCCAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTGTCATTTCTCATCACTGACCACAATTGC; Right flanking sequence: TGGTGAATATTACCAATGAATGGAAGAGGT. sgRNA #1: GCAAAAACTAATGAACCAGC; sgRNA #2: GGTTTGTCCAGTGGCATAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7195 and CGC63. hd7195 is a 2300 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAACTCTTTTTCCACCCGGAAAGCATTCCA; Right flanking sequence: AAAATATTGAATTTAAATATTTAAATGTTA. sgRNA #1: GAAGAACAACAAGGACTTAC; sgRNA #2: CAGGGAAATGACAAACGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7196 and CGC92. hd7196 is a 1856 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TACGCTAATGCAAAGATCTACAGATGTTCT; Right flanking sequence: AGGAAGAGTTACTGCTGTGAAGGGAGACGC. sgRNA #1: AACCAAGAGTGCCCAAGGCC; sgRNA #2: ATTGGATCGTTGTCAACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1578 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACACTGCCGGTTTTGCACGGAAATGTGCCA; Right flanking sequence: TACCAACGATTCTCTTTCAGTTTTAAATTT. sgRNA #1: CTTCGGAGATACAGAGCACG; sgRNA #2: TTTTGTAATAGGCACTGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1318 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGACCTGCTTAGATTATTAATAGAATACT; Right flanking sequence: TGGATTTTCATAGTCTTGGAACTCGTGAAT. sgRNA #1: TTCCAAAGCGAAGATCAAAT; sgRNA #2: TCTCCCAATTTCAACAGTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6980 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGTTTTGCAACATACCGAAACTAGAGTA; Right flanking sequence: ACCACGTTTTCACTCAAAGCCCACCCTCCT. sgRNA #1: CACATTCCAATAATACCTCG; sgRNA #2: CATCCAGCTGATGCTTTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1080 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTTAATTTGAAGTTTTCCATTAATTCCA; Right flanking sequence: GGGTTTTTCTTCGCAAGATTCACGTTTCGG. sgRNA #1: GCTTCATAAATGCATATTCC; sgRNA #2: TTTAATGATACTTTTAGGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking viable fertile GFP+ and mCherry+. Apparent homozygous lethal or sterile deletion balanced with tmC6. Heterozygotes are wild-type GFP+ and mCherry and segregate wild-type GFP+ mCherry, GFP+ homozygotes, and Dpy mCherry+ homozygotes. Derived from parental strains VH204 and FX30138. hd7204 is a deletion of 3569 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGAACACCAGGCGACTGTATTGAACATTTG; Right flanking sequence: GAATGTCCGAATTTCTCGGTTTTTGCGTAT. sgRNA #1: GATTGATAGGCAGACTCCGG; sgRNA #2: GATGATGGATGTCGGAGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking viable fertile GFP+ and Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III+. Apparent homozygous lethal or sterile deletion stabilized over oxTi731. Heterozygotes are wild-type GFP+ and tdTomato+ and segregate wild-type hereozygotes (GFP+ tdTomato+), hd7198 homozygotes (GFP+), oxTi731 homozygotes (tdTomato+), and occasional hd7198 oxTi731 recombinants. Derived from parental strains VH7198 and EG7887. hd7198 is a deletion of 1473 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACCCGCCAAATTCATCAAACAATTCCCG; Right flanking sequence: CGGCGACTACATTGATACTACGAGAAATTG. sgRNA #1: CATAAAAACCGAGGAGCCGG; sgRNA #2: CGAAACTACGAGGCTCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7202 and CGC63. hd7202 is a 541 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTAAAAACAATGGTTCAAGGAAAGCTCAAG; Right flanking sequence: TTGATGCTCTTTTGTTACGAACTTTATACC. sgRNA #1: CAAAAGACAGCCTTGCCAAA; sgRNA #2: AAAAGTGATTTCGTAGGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 670 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAAAAAACGATAAAAAATGCTTATAAAAT; Right flanking sequence: AGGTGATCGCAGTGCCAACGAGTGTAGCAG. sgRNA #1: ATTATTTTCAGACGCTGTCC; sgRNA #2: CCGCGAAGAGAAGCAATTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7205 and CGC63. hd7205 is a 672 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GACTCGAACTCAATTTGCATGTTGATAGTT; Right flanking sequence: TGGTTAGAAAAAGATACGGAGAGGAGAAGT. sgRNA #1: CCAATGTTAAAGAAAGTCTT; sgRNA #2: AAACTCTCTTATAGCACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking viable fertile GFP+ and mCherry+. Apparent homozygous lethal or sterile deletion balanced with FX30266. Heterozygotes are wild-type GFP+ and mCherry and segregate wild-type GFP+ mCherry, GFP+ homozygotes, and tmIs1226 mCherry+ homozygotes. Derived from parental strains VH7179 and FX30266. hd7179 is a deletion of 1609 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGACATTGCACACCGGACGATGAATCTCCA; Right flanking sequence: TGGAATATCCATCACCTGTAGAAATAAAAA. sgRNA #1: GGCAAAAGCTTTCCAAAACG; sgRNA #2: TCGAAAACTCGCCGTGCCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F10G7.2. External left primer: AGAACTTTGTCGGATCGATTGT. External right primer: TCTCCGTACTCCCAAATGTTCT. Internal left primer: AAAGAGACTTCGCTTGTGGAAG. Internal right primer: ACCTTCTTGTTTCCACTGTCGT. Internal WT amplicon: 1729 bp. Deletion size: 878 bp. Deletion left flank: AACAACTTTATAAAATTGTATTTTTTTTTT. Deletion right flank: ACGTCCAACTCACTTCTGATGCTTTCGCCC. This strain was provided by the Hutter Lab at Simon Fraser University (Burnaby, BC), which should be acknowledged in any publications resulting from its use.

maIs105 [col-19::GFP]. Retarded heterochronic phenotype. Worms exhibit supernumerary adult-stage molt and are often unable to exit the molt, becoming trapped in the cuticle. col-19::GFP expression is reduced in hyp7 at the L4 molt. n4037 deletion is between 2891 and 3682 of clone B0395. mir-84 is at 3351-3330 in B0395.

Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Precocious heterochronic phenotype, omission of L2-stage program resulting in fewer seam cells by the L3 stage worms. Precocious alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

ctIs39 [hbl-1::GFP + rol-6(su1006)]. Rollers and GFP+. Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. ctIs39 [hbl-1::GFP]: integrated reporter codes for 133 amino acids of HBL-1 followed by GFP, and contains 1.4 kb of hbl-1 3' UTR plus an NLS. hbl-1::GFP is elevated in the hypodermal syncytium at the L3 stage. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. Vul. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Weak retarded heterochronic phenotype with incomplete alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).

Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are:TCAAAAAAAAACTTCAAT / ATTTTTATGGTATCTTAC...CGAATCTCTTCAAGCAAT / TGGTACTATCTCGATGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Deletion breakpoints are: ATTCATATTTCGATTAATAAAATTACCAAACA / CAATCCAACATAA...ATGGATACGCAGTA / AGAACAATATATGAACGATCGAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

tm3024 deletion was generated by S. Mitani. Outcrossing was performed by M. Ow.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.

maIs105 [col-19::GFP]. Retarded heterochronic phenotypes: extra seam cells and alae gaps in young adults. ma385 is a 1681 bp deletion of the lin-46 gene. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).

Maintain at 20C. maIs105 [col-19::GFP] V. ma447 is a F180(deletion) mimicking human AGO1 F180 mutation. Adult ma447 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.

Maintain at 20C. ma447 is a F180(deletion) mimicking human AGO1 F180 mutation. Adult ma447 mutants exhibit reduced or absent COL-19::GFP expression in Hyp7 cells. Defective vulval development and adult lethality are more penetrant at restrictive temperature (25C). Reference: Duan Y, et al. Proc Natl Acad Sci USA. 2024 Mar 5;121(10):e2308255121. doi: 10.1073/pnas.2308255121. PMID: 38412125.

maIs105 [col-19::GFP]. Precocious heterochronic phenotypes: fewer seam cells and protruding vulva in young adults and patches of alae in L4 larvae. ma467 is a 12 bp deletion in the 5'UTR of the lin-46 gene, which results in gain-of-function of lin-46. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Retarded Heterochronic defects: extra seam cells and partial or no alae in young adults. hbl-1(ma430ma475) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1 and part of the 3' UTR removed. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).

B0228.5 Homozygous. Exhibits slightly shortened lifespan compared to wild-type. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/ Reference: Miranda-Vizuete A, et al. FEBS Lett. 2006 Jan 23;580(2):484-90.

sv47 deletion removes bases 721-2383 of the trxr-1 genomic sequence (as measured from the start of the trxr-1 coding sequence). tm2047 removes bases -128 to +380 relative to the start of the trxr-2 coding sequence (removing part of the proximal promoter). tm2047 outcrossed 6x. sv47 outcrossed 10x. Reference: Cacho-Valadez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.

sv47 deletion removes bases 721-2383 of the trxr-1 genomic sequence (as measured from the start of the trxr-1 coding sequence). ok2267 removes bases +114 to 1751 relative to the start of the trxr-2 coding sequence. ok2267 outcrossed 6x. sv47 outcrossed 10x. Reference: Cacho-Valadez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.

uthIs248 [aak-2p::aak-2(genomic aa1-321)::GFP::unc-54 3'UTR + myo-2p::tdTOMATO]. Ubiquitous GFP expression and pharynx-specific tdTomato expression. Small with slight developmental delay and reduced reproductive capacity. Some phenotypes silence quickly. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.

C. briggsae strain. Reduced fecundity at 20°C and 25°C. Generated by CRISPR/Cas9 in AF16 background, prg-1(how21) is a 5 bp deletion located 47 bp downstream of the start codon that causes frameshift. prg-1(how21) is presumed null; consistent with previous findings that the stability of piRNAs and Piwi protein are co-dependent in C. elegans, the overall abundance of 21 U-RNAs in Cbr-prg-1(how21) was reduced to ~1% of wild-type. Reference: Pastore B, et al. RNA Biol. 2022 Jan;19(1):1276-1292. doi: 10.1080/15476286.2022.2149170.

Temperature sensitive: maintain at 15-20C. Reduced number of progeny and mortal germline phenotype at elevated temperatures. Engineered mutations of FG repeats in three Vasa like GLH proteins (GLH-1, GLH-2 and GLH-4). glh-1(jog50) is F to A substitution. glh-4(jog16) is F to A substitution. glh-2(jog49) is a deletion of the FG repeats. This strain exhibits a subtle change in germ granule composition while maintaining their architecture. WAGO-4 is mislocalized to the cytoplasm leading to compromised function.

srf2119 is a 965bp deletion within znf-598. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369

srf730 is a 900bp deletion within hbs-1. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369

srf780 is a deletion of the Smr nuclease domain of nonu-1. Unc. GFP expression in body wall muscle. Reference: Glover ML, et al. Cell Rep. 2020 Mar 31;30(13):4321-4331.e4. doi: 10.1016/j.celrep.2020.03.023. PMID: 32234470.

Heterozygotes are WT and segregate WT, DpyUncs, and Unc-4 animals which arrest at the L4 stage. Rarely, a recombination will occur and unc-4 and pir-1 will become unlinked. Propagate the strain by picking single WT animals and checking for correct segregation of progeny. 6/2007: Daniel Chavez notes that tm1496 may also delete part of sec-5, which could be responsible for the developmental arrest of tm1496.

Temperature sensitive sterile. Will throw dead eggs at 25C. 292 bp deletion.

RNAi deficient. Temperature-sensitive sterile. In-frame deletion. Reference: Chen CC, et al. Curr Biol. 2005 Feb 22;15(4):378-83.

T07D3.7. Homozygous viable, contains an out of frame deletion removing nucleotides encoding amino acids 34-374. This strain cannot be distributed to for-profit companies. Do not distribute this strain; other labs should request it from the CGC. URL: http://www.celeganskoconsortium.omrf.org.

Pick GFP+ to maintain. sprDf1 is a ~0.25 Mb microdeletion allele on the left arm of chromosome V that removes 32 adjacent protein-coding genes, including mex-5. Heterozygous animals (GFP+) are fertile, but sometimes die by bursting, will have polynucleated embryos, and form uterine tumors ~6 days after hatching. sprDf1 homozygotes (GFP-) have maternal effect lethality, are small, sterile, form large uterine tumors that consist of poly nucleated embryos, have squashed vulvas, are uncoordinated, and die by bursting within eight days of hatching. nT1 homozygotes are inviable (dead eggs). Reference: Antkowiak KR, et al. G3 (Bethesda). 2023 Nov 13:jkad258. doi: 10.1093/g3journal/jkad258. PMID: 37956108.