More Fields
Strain Species Genotype
VC495 C. elegans mir-2(gk259) I. Show Description
M04C9.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VT1361 C. elegans mir-2(n4108) I. Show Description
Deletion breakpoints are:TCAAAAAAAAACTTCAAT / ATTTTTATGGTATCTTAC...CGAATCTCTTCAAGCAAT / TGGTACTATCTCGATGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14117 C. elegans mir-2(n4108) I; nDf49 II. Show Description
mir-42, mir43 and mir-44 are deleted in nDf49. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT17848 C. elegans mir-2(n4108) I; nDf49 II; nDf59 V; mir-247(n4505) X. Show Description
mir-2 family and most of mir-44 family are removed in this strain (mir-45 is present). Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
CGC110 C. elegans mir-250(umn21[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272)] V. Show Description
mir-250 pre-miRNA deletion strain deletion allele in which mir-250 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC111 C. elegans mir-250(umn22[lox2272 myo-2p::wrmScarlet + lox511I + lox2272)] V. Show Description
Derived by CRE-meditated excision of SEC in parental strain CGC110, leaving myo-2p::wrmScarlet.
CGC112 C. elegans mir-250(umn23[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC110, leaving disrupted mir-250 locus.
CGC113 C. elegans mir-61&mir-250(umn24[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272)] V. Show Description
mir-61&mir-250 pre-miRNA deletion strain deletion allele in which mir-61&mir-250 pre-miRNAs were replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC114 C. elegans mir-61&mir-250(umn25[lox2272 myo-2p::wrmScarlet + lox511I + lox2272)] V. Show Description
Derived by CRE-meditated excision of SEC in parental strain CGC113, leaving myo-2p::wrmScarlet.
CGC115 C. elegans mir-61&mir-250(umn26[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC113, leaving disrupted mir-61&mir-250 loci.
CGC131 C. elegans mir-248(umn41[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-248 pre-miRNA deletion allele in which mir-248 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC137 C. elegans mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
CGC159 C. elegans mir-61&mir-250(umn66[mir-61p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus
CGC161 C. elegans mir-266(umn68[mir-266p::SL1::EGL13NLS::lox2272)] X. Show Description
Deletion of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC162 C. elegans mir-266(umn69[mir-266p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-266 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-266 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CGC163 C. elegans mir-271(umn70[mir-271p::SL1::EGL13NLS::lox2272)] X. Show Description
Deletion of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising mScarlet-I and the SEC leaving a SL1::EGL13NLS::lox2272 scar.
CGC164 C. elegans mir-271(umn71[mir-271p::SL1::EGL13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3' UTR::lox2272]) X. Show Description
mScarlet replacement of mir-271 pre-miRNA. A cassette containing mScarlet-I and an SEC flanked by lox2272 was introduced into the mir-271 loci using CRISPR/Cas9. This line was generated by excising SEC leaving the SL1::EGL13NLS::mScarlet-I::cMycNLS::let-858 3' UTR transcriptional reporter in the loci.
CT17 C. elegans zaEx18. Show Description
zaEx18 [mir-237::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype.
CT22 C. elegans zaIs6. Show Description
zaIs6 [mir-239.1p::GFP + myo-2p::DsRed]. Reference: de Lencastre A, et al. Curr Biol. 2010 Dec 21;20(24):2159-68.
JK5455 C. elegans q833 V/nT1[qIs51](IV; V). Show Description
hets are green pharynx WT and segregate green pharynx WT, fertile non-green pharynx and dead eggs (nT1 homozygotes). q833 is a 472 bp deletion into the intergenic region between mir-61/ mir-250 and F55A11.4.
MJS209 C elegans unc-119(ed3) III; qbcSi9 IV. Show Description
qbcSi9 [mex-5p::GFP::his-58::3XmiR-228::tbb-2 3’UTR + unc-119(+)] IV. Germline-specific miR-228 miRNA GFP reporter. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
MJS210 C elegans unc-119(ed3) III; qbcSi10 IV. Show Description
qbcSi10 [mex-5p::GFP::his-58::3XmiR-228(mut)::tbb-2 3’UTR + unc-119(+)] IV. Germline-specific miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
MJS276 C elegans unc-119(ed3) III; qbcSi12 IV. Show Description
qbcSi112 [elt-2p::GFP::his-58::3XmiR-228(mut)::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
MJS277 C elegans unc-119(ed3) III; qbcSi11 IV. Show Description
qbcSi11 [elt-1p::GFP::his-58::3XmiR-228::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
MLC113 C. elegans ttTi5606 mir-236(luc2[unc-119(+)]) II; unc-119(ed3) III. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-236 deletion allele; miRNA hairpin replaced by unc-119.
MLC698 C. elegans mir-255(luc38) V. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-255 deletion allele removes the hairpin (breakpoints: aaactttcgttgctgcgaaat...ccattcaattaatttcccgcatttcttaatttttgagctttttctt).
MT12969 C. elegans mir-259(n4106) V. Show Description
Deletion breakpoints are: GATTATAATGCAAACAACCTGGGGGATC / CAGTATCTTCA...AAGAGCGAAAGT / ACAGTCTCCTCCTTCTTTGCTCACTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT12983 C. elegans mir-238(n4112) III. Show Description
Deletion breakpoints are: ACAACTTAATATCTTTTCTGGTCATTTTCAA / TACTTACCTCA...AGGTGACAGAAA / GTTGTGTGAAAATGACAAATATCTCTTTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13016 C. elegans nDf52 III. Show Description
nDf52 removes mir-229 and mir-64. Deletion is 652 bp from -525 to 128 from 5'end of mir-64. Reference: PLos Genet (2007) 3(12):e215.
MT13653 C. elegans mir-237(n4296) X. Show Description
Deletion breakpoints are:GAAGATCATTCTTAAATCTGTTTAGCA / TTTTGAAAGTTT...ACTGCATTAGAACT / GCAAAAAAAAGTTTCGAGAAAAGTGGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT13669 C. elegans nDf51 V. Show Description
Retarded heterochronic phenotype. Worms reiterate L2-stage programs, have extra seams cells, gapped alae, and >30% burst at the vulva at the L4 molt. Phenotype suppressed post-dauer. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
MT13897 C. elegans mir-241(n4316) V. Show Description
Superficially WT. Deletion is in cosmid F56A12 from 7299-7756. mir-241 is at 7661-7681.
MT14118 C. elegans mir-241(n4315) V; mir-84(n4037) X. Show Description
Superficially WT.
MT14128 C. elegans nDf53 III; nDf54 X. Show Description
Removes mir-80, mir-81, mir-82, mir-227, and T07D1.2 (exons 2-6). Reference: Alvarez-Saavedra E, Horvitz HR. Curr Biol. 2010 Feb 23;20(4):367-73.
MT14347 C. elegans mir-273(n4438) II. Show Description
Deletion breakpoints are:TGGTACTGGCCCCACTTTGATAGT / CTCAAGGCTT...TTAGCGCTAT / AAAAATTTGTACATCTCTGCTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14446 C. elegans mir-228(n4382) IV. Show Description
Deletion breakpoints are: GTACACAGAACAATAGAAATCGCCT / CGTTTCTGTTT...CTACGATATTAT / GTCCGAATTAAATTGCTTTTTTTTTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14449 C. elegans mir-232(nDf56) IV. Show Description
Deletion breakpoints are: GATGTATTGGGAGTCTTTTTAGGT / TATGGACCAGG...TTTCGTGCGT / CACTTTTTTTATAAGCTCTACCGTATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14525 C. elegans mir-254(n4470) X. Show Description
Deletion breakpoints are: AAAATTTATTGAATTTTT / ATGAAGAATTACTATAAT...TCCAGGAGTGCAGTACGA / TCTCGAACCATGTTTTCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14588 C. elegans mir-234(n4520) II. Show Description
Deletion breakpoints are:CAACGTTTCCAAACTGT / AACGTAAATATACAACAC...TGATGGGGGGGGGGGGTCAAGGAAA / GAAGAAAAGGGAAGAAAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14661 C. elegans mir-265(n4534) IV. Show Description
Deletion breakpoints are:ACTTTCGAAAAATTTTGCCAT / GTTTTCCAATTT...TATTATTTTCAGAAA / GCCAAAATATTTCTAAATTCCTATATAAATTTCAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14662 C. elegans mir-230(n4535) X. Show Description
Deletion breakpoints are:ACATCATCATCATAACAA / GCCTTTCACAAATAAGATC...ACTTATATTTCTTGTTTATTTTTTT / AAATGTTTTTTTTACTATTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14682 C. elegans mir-257(n4548) V. Show Description
Deletion breakpoints are:GACCTTGGACTTCAGCACATCCGGTTTTCCA / CTCGGAACTTGACG....CCTGCAGTTCTTCCAT / GATGTACTCAGGGCCTTTAATTTTGTACATGCTCCATAGGAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14748 C. elegans nDf51 V; nEx1184. Show Description
nEx1184 [sur-5::GFP]. Maintain by picking GFP+. nEx1184 rescues the lethality and extra seam cells in nDf51. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
MT14768 C. elegans mir-231(n4571) III. Show Description
Deletion breakpoints are: CATAAATTTCAGGAAAGC / ATGTGGTAAAATATGAAT...ATGTGAATGAAAATAAACC / GCCAAAAATATCAAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14778 C. elegans nDf51 V; nEx1192. Show Description
nEx1192 [sur-5::GFP]. Maintain by picking GFP+. nEx1192 does not rescue the lethality and extra seam cells in nDf51. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
MT14875 C. elegans nDf59 V. Show Description
mir-61 (F55A11.9), mir-250 (F55A11.12) and part of F55A11.3 are deleted in nDf59. Deletion breakpoints are:TGGATTTCCACAACAACCAGCTGGTGCC / GGAGGTGCTCAGCCTGG...GTTCTAGTCATTGCC / ATACGGAGGAAGGACTAAGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14876 C. elegans mir-261(n4594) II. Show Description
Deletion breakpoints are:TTTTCGAATTGGCTTATG / AACCGATGGCATTTTCTTCTC...TGCAAATTGGGGCCAACA / ATACAATAGGTGTAAAATGGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14878 C. elegans mir-270(n4595) IV. Show Description
Deletion breakpoints are:AGTTTGGAAAACTGTGCTAGAATGAGAAAAGTTGCTGAAATGAT / GAAAAAGCG...TCGGACTTTA / CCCTTCGCCCCTTATCACACCATTCTATCAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14919 C. elegans mir-260(n4601) II. Show Description
Deletion breakpoints are:TTACTAAAAAAAAAGTGCCTAG / GATTGTCTGAAAATT...CGGCTGAAAAATAT / AAATTTATAACTGGGCAACAGAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects
MT14936 C. elegans mir-242(n4605) IV. Show Description
Deletion breakpoints are: GTACCTAGACAATATTCCT / CACCAACCTCAATTCAACAC...GGCTTAAGCTTAGGCGAATA / CAATCAATTTTTCAAAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.