sEx10385 [rCes ZK632.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx10700 [rCesZK632.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14566 [rCesZK632.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14900 [rCes ZK632.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

ZK632.8. Homozygous. Outer Left Sequence: GACAAGTCATTCCGCGATTT. Outer Right Sequence: TCGTCCAACAAATGATCGAA. Inner Left Sequence: GTTGCACCGCTAAACCCTAA. Inner Right Sequence: GCCAGAAGAAAGTGAGCCAG. Inner Primer PCR Length: 2126 bp. Deletion Size: 1199 bp. Deletion left flank: TCTTCCCGTTCTTTTTTATTCAAACTTATG. Deletion right flank: ATATTAAAATTAAAATTATTTTCAGTTATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK632.3. Homozygous. Outer Left Sequence: CGCTCATCGTCAGTGAAAAA. Outer Right Sequence: GTCAGTTTTGCGGATGTCCT. Inner Left Sequence: CCCATTCCACGTTTTTGAGT. Inner Right Sequence: ACTTGCTCTTCAACGCCATT. Inner Primer PCR Length: 1108 bp. Deletion Size: 371 bp. Deletion left flank: GCCGACCATATCGCCTGTTGGAAGGGTGTT. Deletion right flank: AAGACGAGAATTCGTTGCATTTTCCTCATC. Insertion Sequence: TCCCTTCCAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK632.9 Homozygous. Outer Left Sequence: cgaacatttcgtcatctcca. Outer Right Sequence: cgtctgctgttgattcgcta. Inner Left Sequence: ccaataaatcctagcggacg. Inner Right Sequence: aaagaaatctctacgccacaca. Inner Primer PCR Length: 1179. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK632.6. Superficially wild type. External left primer: ACCTCACATGGTGGAAAAGC. External right primer: ACAGACGCGCTCTAGCAAAT. Internal left primer: AGTTGGCTTCACTGGCTCAT. Internal right primer: CACAATGCCCCTCATTTTCT. Internal WT amplicon: 2586 bp. Deletion size: 1412 bp. Deletion left flank: CGTCTTGCGGTTCTGGATTGCTCTGGGAAC. Deletion right flank: GTTAATTGGATTTTTATAACGGAAAATTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7127 and CGC66. hd7127 is a 1043 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACAGTACTCTTTAAAGGCTCTCAATCTTGT; Right flanking sequence: TGGAAAAGCAGACAAAAAAGGCGAGAAGAA. sgRNA #1: CATTCTACAAAAATGTATCG; sgRNA #2: GTGATTCGTACCTCACATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.