MT13669 |
C. elegans |
nDf51 V. Show Description
Retarded heterochronic phenotype. Worms reiterate L2-stage programs, have extra seams cells, gapped alae, and >30% burst at the vulva at the L4 molt. Phenotype suppressed post-dauer. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
MT14748 |
C. elegans |
nDf51 V; nEx1184. Show Description
nEx1184 [sur-5::GFP]. Maintain by picking GFP+. nEx1184 rescues the lethality and extra seam cells in nDf51. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
MT14778 |
C. elegans |
nDf51 V; nEx1192. Show Description
nEx1192 [sur-5::GFP]. Maintain by picking GFP+. nEx1192 does not rescue the lethality and extra seam cells in nDf51. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1066 |
C. elegans |
nDf51 V; mir-84(n4037) X. Show Description
Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1102 |
C. elegans |
lin-28(n719) I; lin-46(ma164) nDf51 V; mir-84(n4037) X. Show Description
Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1103 |
C. elegans |
lin-28(n719) I; nDf51 V; mir-84(n4037) X. Show Description
Precocious heterochronic phenotype, omission of L2-stage program resulting in fewer seam cells by the L3 stage worms. Precocious alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1142 |
C. elegans |
nDf51 V; mir-84(n4037) X; ctIs39. Show Description
ctIs39 [hbl-1::GFP + rol-6(su1006)]. Rollers and GFP+. Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. ctIs39 [hbl-1::GFP]: integrated reporter codes for 133 amino acids of HBL-1 followed by GFP, and contains 1.4 kb of hbl-1 3' UTR plus an NLS. hbl-1::GFP is elevated in the hypodermal syncytium at the L3 stage. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1143 |
C. elegans |
lin-41(ma104) I; nDf51 V; mir-84(n4037) X. Show Description
Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1145 |
C. elegans |
lin-46(ma164) nDf51 V; mir-84(n4037) X. Show Description
Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. Vul. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1146 |
C. elegans |
nDf51 V; hbl-1(ve18) mir-84(n4037) X. Show Description
Weak retarded heterochronic phenotype with incomplete alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT3297 |
C. elegans |
maIs105 V; mir-793(ma292) X. Show Description
maIs105 [col-19::GFP] V. mir-793(ma292) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma292 allele is missing the 220 nucleotide region between ACCGAGCAAGTTAGAAATCACCGCC and GTATGAATGTTTTTCCTTCAAACAT [chrX:13,857,855-13,858,124 of WBcel235/ce11].
|
|
VT3299 |
C. elegans |
mir-795(ma298) I; maIs105 V. Show Description
maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11].
|
|
VT3301 |
C. elegans |
mir-794 mir-795(maDf5) I. Show Description
mir-794 mir-795(maDf5) enhances retarded phenotypes of mir-48 mir-241 (nDF51). maDf5 allele is missing the 1312 nucleotide region between ATACATATTCCGAGAAACGTTACCT and GTGAGGCGCCAAATGCCGGCCTCAC [chrI:12,594,556-12,595,917 of WBcel235/ce11].
|
|