| FX30266 |
C. elegans |
lin-42(tmIs1226) II. Show Description
Break points: lin-42 II. Covered region (Mb) (1.2) Balancer marked with myo-2p::mCherry. tmIs1226 is integrated in the same site as tmIs1246, but Egl phenotype is not detectable. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30262 |
C. elegans |
lin-42(tmIs1246) II. Show Description
Break points: lin-42 II. Covered region (Mb) (1.2) Balancer marked with myo-2p::Venus. Egl. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| MT2257 |
C. elegans |
lin-42(n1089) II. Show Description
Semi-Dpy, not completely penetrant. L3 molt alae. L2d suppressed.
|
|
| RB1843 |
C. elegans |
lin-42(ok2385) II. Show Description
F47F6.1. Homozygous. Outer Left Sequence: CGGTTACGCATTGAAAGACA. Outer Right Sequence: AGTCCCTTTTGCCTGGATCT. Inner Left Sequence: TTTTGCAGGAAACGTAAAGGA. Inner Right Sequence: AGGGGCCTGATCCTAAGAAA. Inner Primer PCR Length: 3109 bp. Deletion Size: 2632 bp. Deletion left flank: CCGGGTTCAGGCCCATATAGGCCTATAGGC. Deletion right flank: ACGGGGGGCTACCCGGCTGGGTGGGAAGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| RG3328 |
C. elegans |
nsun-1(ve828[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/lin-42(tmIs1226) II. Show Description
tmIs1266 [myo-2p::mCherry, II: lin-42] II. Homozygous larval arrest. Deletion of 1509 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ arrested larvae (ve828 homozygotes) and mCherry+ animals [lin-42(tmIs1226) homozygotes]. Maintain by picking wild-type GFP+ mCherry+. Note: recombination is possible and should be evident by the presence of non-fluorescent animals that are neither GFP+ nor mCherry+. Note from parent strain FX30266: Egl phenotype of lin-42 is not detectable. Left flanking Sequence: CAAAAACTGATTTTTCTGAAATCTAGTCCG; Right flanking sequence: GAGTACACGAGATATCCTGGAAAATTAGAT. nsun-1 sgRNA #1: ATGACGGTTTCAATACGGTA; nsun-1 sgRNA #2: CACGTGCTCTGTACTCGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7215 |
C. elegans |
mcat-1(hd7179[LoxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + LoxP])/ lin-42(tmIs1226) II. Show Description
Maintain by picking viable fertile GFP+ and mCherry+. Apparent homozygous lethal or sterile deletion balanced with FX30266. Heterozygotes are wild-type GFP+ and mCherry and segregate wild-type GFP+ mCherry, GFP+ homozygotes, and tmIs1226 mCherry+ homozygotes. Derived from parental strains VH7179 and FX30266. hd7179 is a deletion of 1609 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGACATTGCACACCGGACGATGAATCTCCA; Right flanking sequence: TGGAATATCCATCACCTGTAGAAATAAAAA. sgRNA #1: GGCAAAAGCTTTCCAAAACG; sgRNA #2: TCGAAAACTCGCCGTGCCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| ALF62 |
C. elegans |
bafIs62. Show Description
bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
|
|
| ALF63 |
C. elegans |
unc-119(ed3) III; bafIs63. Show Description
bafIs63 [lin-42p(mut)::GFP + unc-119(+)]. lin-42p(mut)::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+); all potential DAF-12 binding sites have been mutated. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
|
|
| ALF82 |
C. elegans |
unc-119(ed3) III; daf-12(rh61rh411) X; bafIs62. Show Description
bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Array was crossed into strain ALF3 to create ALF82. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
|
|