| PQ567 |
C. elegans |
alg-2(ap426) II. Show Description
ap426 is a CRISPR-engineered 8 bp deletion in the ALG-2 isoform A exon 2 causing a frameshift that produces a heavily truncated protein. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.
|
|
| PQ582 |
C. elegans |
alg-2(ap431[3xflag::mKate2::alg-2]) II. Show Description
alg-2(ap431[3xflag::mKate2::alg-2]) II. ALG-2 tagged at N-terminal with 3xFLAG:mKate2 at endogenous locus, verified by western blot and fluorescence microscopy. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.
|
|
| RB574 |
C. elegans |
alg-2(ok304) II. Show Description
T07D3.7. Homozygous. Outer Left Sequence: tctgagtttggctcgatgtg. Outer Right Sequence: atgttccttggataccagcg. Inner Left Sequence: agcccagaactgggaaactt. Inner Right Sequence: aagtcgaattccgttggatg. Inner primer WT PCR product: 3297. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| WM53 |
C. elegans |
alg-2(ok304) II. Show Description
T07D3.7. Homozygous viable, contains an out of frame deletion removing nucleotides encoding amino acids 34-374. This strain cannot be distributed to for-profit companies. Do not distribute this strain; other labs should request it from the CGC. URL: http://www.celeganskoconsortium.omrf.org.
|
|
| NL4517 |
C. elegans |
alg-2(ok304) II; pkIs2256. Show Description
pkIs2256 [alg-2::HA + rol-6(su1006)]. Rollers.
|
|
| PQ583 |
C. elegans |
alg-2(ap431[3xflag::mKate2::alg-2]) II; alg-1(ap423[3xflag::gfp::alg-1]) X. Show Description
alg-2(ap431[3xflag::mKate2::alg-2]) II. alg-1(ap423[3xflag::gfp::alg-1]) X. Derived from crossing PQ530 and PQ582 strains, verified by fluorescence microscopy. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.
|
|
| JMC203 |
C. elegans |
alg-2(tor139[GFP::3xFLAG::alg-2b]) II. Show Description
GFP and 3xFLAG tags inserted into endgonenous alg-2 locus; specifically tags b-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
|
|
| MCJ133 |
C. elegans |
alg-2(cdb12 cdb51[3xFLAG::alg-2]) II. Show Description
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-2 locus. sgRNA #1: TCGTCTTTCATGCCAGATGG; sgRNA #2: AAGTGCAGACATACTTAAGT; sgRNA #3: GCTACCATAGGCACCACGAG; sgRNA #4: GCTACCATAGGCACCACGAG. sgRNA #4 was used both for co-CRISPR to mark jackpot founder plates and for modification of cdb12, an edit that introduced a site editable by this gRNA. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
|
|
| MCJ288 |
C. elegans |
alg-2(cdb155[D627A]) II. Show Description
cdb155 is an engineered D627A substitution in the short isoform of alg-2, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-2. sgRNA #1: GATGGGTGATGTCGCAACCC. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
|
|
| MCJ639 |
C. elegans |
alg-2(cdb12 cdb51[3xFLAG::alg-2] cdb370[D627A]) II. Show Description
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-2 locus. cdb370 is an engineered D627A substitution in the short isoform of alg-2, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-2. sgRNA #1: GATGGGTGATGTCGCAACCC. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
|
|