| CER348 |
C. elegans |
trxr-1(cer35[Sec666C]) IV. Show Description
Missense mutation selenocysteine to cysteine. Resistant to cisplatin exposure. Primers to genotype this missense mutation and other silent mutations: [Common Fw: GGCTTCCACATTCTCACTCC] [RV wildtype: CTTAACCTCAGCAACCAGAA] [RV Sec to Cys: CTTAACCGCAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).
|
|
| CER374 |
C. elegans |
trxr-1(cer55[Sec666X]) IV. Show Description
Missense mutation engineered by CRISPR removes a selenocysteine to place a stop codon. Resistance to cisplatin exposure. Primers to genotype the cer55 and other silent mutations: [Common Fw: #1224 GGCTTCCACATTCTCACTCC] [RV wildtype: #1414 cTTAACCTCAGCAACCAGAA] [RV Sec to STOP: #1421 CTTAACCTTAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).
|
|
| TQ10548 |
C. elegans |
trxr-1(xu421) IV. Show Description
trxr-1(xu421) is a W275* nonsense mutation; suppresses LITE-1 function. Reference: Zhang W, et al. PLOS Genetics 2020 Dec 10;16(12):e1009257. PMID: 33301443
|
|
| RB1961 |
C. elegans |
C06G3.7(ok2580) IV. Show Description
C06G3.7 Homozygous. Outer Left Sequence: gccgagacaacaagaaggtt. Outer Right Sequence: tcatacatcacacgacgcaa. Inner Left Sequence: tcgatttttcacagaaattgttaag. Inner Right Sequence: gagaaaaaccaaagagcagca. Inner Primer PCR Length: 3009. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VZ14 |
C. elegans |
trxr-2(tm2047) III; trxr-1(sv47) IV. Show Description
sv47 deletion removes bases 721-2383 of the trxr-1 genomic sequence (as measured from the start of the trxr-1 coding sequence). tm2047 removes bases -128 to +380 relative to the start of the trxr-2 coding sequence (removing part of the proximal promoter). tm2047 outcrossed 6x. sv47 outcrossed 10x. Reference: Cacho-Valadez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
|
|
| VZ21 |
C. elegans |
trxr-2(ok2267) III; trxr-1(sv47) IV. Show Description
sv47 deletion removes bases 721-2383 of the trxr-1 genomic sequence (as measured from the start of the trxr-1 coding sequence). ok2267 removes bases +114 to 1751 relative to the start of the trxr-2 coding sequence. ok2267 outcrossed 6x. sv47 outcrossed 10x. Reference: Cacho-Valadez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
|
|