| BE38 |
C. elegans |
dpy-2(sc38) II. Show Description
Temperature sensitive. Left hand Roller and Dpy at 25C. Dpyish at 16C. Recessive.
|
|
| BE93 |
C. elegans |
dpy-2(e8) II. Show Description
Dpy. Recessive.
|
|
| CB1359 |
C. elegans |
dpy-2(e1359) II. Show Description
Roller. Temperature sensitive.
|
|
| CB489 |
C. elegans |
dpy-2(e489) II. Show Description
Temperature sensitive. Left hand Roller. Recessive. M-MATING-NO SUCCESS.
|
|
| FX19668 |
C. elegans |
tmC6 [dpy-2(tmIs1189)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30138 |
C. elegans |
tmC6 [dpy-2(tmIs1208)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| FX30144 |
C. elegans |
tmC6 [dpy-2(tm9710)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
| GE1708 |
C. elegans |
dpy-2(e8) unc-4(e120) II. Show Description
DpyUnc.
|
|
| GE1711 |
C. elegans |
dpy-2(e8) vab-9(e1744) unc-4(e120) II. Show Description
Dpy. Unc. Tail whip knobbed at all stages except adult male (adult male tail tip slightly swollen).
|
|
| SL740 |
C. elegans |
dpy-2(e8) unc-4(e120)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- DpyUncs.
|
|
| ML335 |
C. elegans |
dpy-2(e489) mcDf1 unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, dead eggs and DpyUncs. mcDf1 homozygotes arrest as dead eggs.
|
|
| GE1210 |
C. elegans |
dpy-2(e8) ooc-3(t1308)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, Dpys which produce dead eggs, and DpyUncs.
|
|
| MG8 |
C. elegans |
csc-1(t1171) dpy-2(e8)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and Dpys which give only dead eggs. Throws males.
|
|
| ML93 |
C. elegans |
dpy-2(e489) lin-26(mc1) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and dead eggs (mc1 homozygotes). mc1 is a strong loss of function mutation, but probably not null. mc1 is an embryonic lethal mutation with degeneration of hypodermal cells.
|
|
| FX17788 |
C. elegans |
mlt-7(tm1794)/tmIn4 II. Show Description
Heterozygotes are slightly Dpy, and segregate slightly Dpy mlt-7/tmIn4 heterozygotes, Dpy tmIn4 homozygotes, and mlt-7(tm1794) homozygotes (Let). Break points: In(lin-8 dpy-2) II. Covered region (Mb) 3.7 (3.1..6.7) Dpy. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.
|
|
| PHX4550 |
C. elegans |
dpy-2::mNG(syb4550) II. Show Description
mNG inserted at C-terminus of endogenous dpy-2 locus.
|
|
| RG3332 |
C. elegans |
skpo-2(ve832[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Embryonic lethal. Deletion of 3081 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry dead eggs (ve832 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: GTGGGGAAAGATGCTAGACGGCTAGCTCCT; Right flanking sequence: AGGTCGTGGCGATCTTTGCAGGATTTGCTG. skpo-2 sgRNA #1: GGACTACAATGCCTGGAAAG; skpo-2 sgRNA #2: TCGAGGACCAGAATTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3505 |
C. elegans |
tsr-1(ve1005[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Sterile. Deletion of 7616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry sterile adults (ve1005 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Note: tsr-1 is near ZK1240.1, the gene marking the breakpoint of the tmC6 balancer. Left flanking Sequence: aaatTTAGATGAACAGCTTGGCGAGATCAC; Right flanking sequence: tagtgagctctagttttcggtgtctaggct. tsr-1 crRNA A: GAGTATGGTTGAAGACGGCG; tsr-1 crRNA B: gctcaattttgaagtctcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7210 |
C. elegans |
pigw-1(hd7204[LoxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
Maintain by picking viable fertile GFP+ and mCherry+. Apparent homozygous lethal or sterile deletion balanced with tmC6. Heterozygotes are wild-type GFP+ and mCherry and segregate wild-type GFP+ mCherry, GFP+ homozygotes, and Dpy mCherry+ homozygotes. Derived from parental strains VH204 and FX30138. hd7204 is a deletion of 3569 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGAACACCAGGCGACTGTATTGAACATTTG; Right flanking sequence: GAATGTCCGAATTTCTCGGTTTTTGCGTAT. sgRNA #1: GATTGATAGGCAGACTCCGG; sgRNA #2: GATGATGGATGTCGGAGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| AMH82 |
C. elegans |
ccIs4251 I; ddi-1(ok1468) IV. Show Description
ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. ddi-1 also known as vsm-1.
|
|
| ATU3301 |
C. elegans |
ccIs4251 I; aceIs1. Show Description
ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator mitochondrial LAR-GECO in all body wall muscles.
|
|
| BA824 |
C. elegans |
spe-26(hc139) dpy-20(e1282) IV. Show Description
Temperature sensitive. Partially fertile at 16C (very few progeny). Sterile at 20C and 25C. Weak Dpy at 15C. Spermatogenesis arrests at the spermatocyte stage.
|
|
| BA825 |
C. elegans |
spe-26(hc140) dpy-20(e1282)/+ IV. Show Description
Heterozygotes are WT and segregate wild-type, wild-type heterozygotes, and Sterile Dpy (spe-4 dpy-20 homozygotes). Homozygous mutants are weak Dpy and partially fertile at 15C. Sterile at 20-25C. Spermatogenesis arrests at the spermatocyte stage.
|
|
| BA901 |
C. elegans |
spe-27(it110) dpy-20(e1282) IV. Show Description
Temperature sensitive Dpy. Male/hermaphrodite mating strain. Hermaphrodites self-sterile at all temps; males fertile. Spermatids arrest with spikes in pronase; form normal pseudopods in TEA.
|
|
| BA925 |
C. elegans |
spe-26(hc138) dpy-20(e1282) IV. Show Description
Temperature-sensitive. Fertile and weak Dpy at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.
|
|
| BA959 |
C. elegans |
spe-29(it127) dpy-20(e1282) IV. Show Description
Homozygous male/hermaphrodite line. Males are fertile. Hermaphrodites are sterile, but slightly leaky producing a few progeny (at 25C - ts not tested). In pronase, spermatids from males activate to form many long spikes, terminating at this stage. A very few (1-3 per worm) activate to form normal-looking, motile spermatozoons.
|
|
| BA969 |
C. elegans |
spe-6(hc163) III; spe-27(it132) dpy-20(e1282) IV. Show Description
Dpy. spe-6(hc163) is a recessive suppressor of spe-27(it132). spe-6(hc163) also suppresses spe-8, spe-12, spe-29 and other spe-27 alleles. Causes precocious spermatid activation. Fertile between 15-25C.
|
|
| BA971 |
C. elegans |
spe-27(it132) dpy-20(e1282) IV. Show Description
Temperature sensitive spe-27 allele. Leaky sterile at 20C. Males at 20C produce spermatids that form spikes in pronase. Males are fertile. Temperature sensitive dpy-20 allele. Maintain at 15C.
|
|
| BA975 |
C. elegans |
spe-6(hc163) III; spe-29(it127) dpy-20(e1282) IV. Show Description
spe-6(hc163) suppresses the self-sterility of spe-29 in this strain. Self-sterile at 25C.
|
|
| BC4586 |
C. elegans |
unc-76(e911) rol-9(sc148)/sC4(s2172) [dpy-21(e428)] V. Show Description
Heterozygotes are WT and segregate WT and Unc Rollers. sC4(s2172) is not viable as a homozygote. As a heterozygote it reduces recombination between unc-76 and rol-9 to 1.8%.
Note: This strain has been sequenced and the sC4 balancer contains a large deletion from V:16,060,619 to V:19,331,432 that removes 1,279 genes and has a complex rearrangement on LGIV. See Maroilley et al. Sci Reports (2021)11:18258 for more details.
doi.org/10.1038/s41598-021-97764-9
|
|
| BP172 |
C. elegans |
muIs65 II; hyEx21. Show Description
hyEx21 [hsp-16.2p::eff-1 + rol-6(su1006)]. muIs65 [ajm-1::GFP + dpy-20(+)]. AJM-1 marks epithelial junctions. Pick Rollers to maintain.
|
|
| BS509 |
C. elegans |
ozDf2/dpy-21(e428) par-4(it33) V. Show Description
Heterozygotes are wild-type and segregate wild-type (heterozygotes), Dpys (dpy-21 par-4 homozygotes that lay dead eggs), and dead eggs (ozDf2 homozygotes). Maintain by picking wild-type.
|
|
| BT14 |
C. elegans |
fbl-1(hd43)/dpy-20(e1282) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Steriles (hd43 homozygotes) and Dpy Uncs.
|
|
| CB1282 |
C. elegans |
dpy-20(e1282) IV. Show Description
Dpy. Temperature sensitive. Lethal cold sensitive. Male lethal. M-MATING++ 1-10%WT.
|
|
| CB2810 |
C. elegans |
tra-1(e1575)/+ III; unc-42(e270) him-5(e1490) dpy-21(e428) V. Show Description
Pick Unc hermaphrodite to maintain (these will be tra-1/+; unc-42 him-5 dpy-21 XO animals). Segregates Unc hermaphrodites (tra-1/+ III), Unc males (+/+ III), and DpyUnc hermaphrodites (+/+ III). dpy-21 not expressed in XO. dpy-21(e428) V; XX animals are weak Dpy. dpy-21(e428) V; XO animals are non-Dpy.
|
|
| CB3252 |
C. elegans |
rnt-1(e1241) I; him-5(e1490) dpy-21(e428) V. Show Description
Hermaphrodites are Dpy and Him. Males are non-Dpy and Mab. Males have abnormal bursa and defective rays. Both sexes show lateral hypodermis lineage defexts. M-MATING+POOR <1%WT.
|
|
| CB3253 |
C. elegans |
dpy-23(e840) lon-2(e678) X. Show Description
Variably Dpy, slow growing. Inviable on MYOB medium.
|
|
| CB3298 |
C. elegans |
him-5(e1490) dpy-21(e428) V; mab-7(e1599) X. Show Description
Hermaphrodites are Dpy. Males are non-Dpy and have abnormal bursae in adult, with swollen rays. Males will mate, but with very low efficiency. [3/98: King Chow isolated a line from the CGC stock that was throwing 100% Mabs. Sent the strain back to the CGC to replace the old stock.]
|
|
| CB3299 |
C. elegans |
mab-5(e1239) III; him-5(e1490) dpy-21(e428) V. Show Description
Hermaphrodites are Dpy and segregate males. Males are non-Dpy and Mab. Both sexes show lineage alterations.
|
|
| CB3353 |
C. elegans |
mab-9(e1245) II; him-5(e1490) dpy-21(e428) V. Show Description
Hermaphrodites are Dpy and segregates males. Males are non-Dpy and have severe tail abnormalities; frequently lethal to adult males.
|
|
| CB3497 |
C. elegans |
dpy-25(e817) II. Show Description
Dpy. Severe. Semidominant. Inviable at 15C.
|
|
| CB3775 |
C. elegans |
dpy-20(e2017) IV. Show Description
Severe roundheaded Dpy. Almost inviable at 15C.
|
|
| CB3823 |
C. elegans |
eDf18/unc-24(e138) dpy-20(e1282) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
|
|
| CB3824 |
C. elegans |
eDf19/unc-24(e138) dpy-20(e1282) IV. Show Description
Heterozygotes are WT (somewhat Unc and Egl) and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
|
|
| CB3843 |
C. elegans |
fem-3(e1996)/unc-24(e138) dpy-20(e1282) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and fertile females.
|
|
| CB3874 |
C. elegans |
dpy-20(e2017) IV; sup-28(e2058) X. Show Description
Partly or completely suppressed Dpy.
|
|
| CB3875 |
C. elegans |
sup-23(e2059) dpy-20(e2017) IV. Show Description
Weak suppression of dpy-20 by sup-23. Medium Dpy.
|
|
| CB3908 |
C. elegans |
sup-22(e2057) dpy-20(e2017) IV. Show Description
Weak suppression of dpy-20 by sup-22. Dpy phenotype, but less Dpy than dpy-20 alone.
|
|
| CB3909 |
C. elegans |
dpy-20(e2017) IV; sup-21(e1957) X. Show Description
Suppressed Dpy. e1957 previously called sup-21.
|
|
| CB3911 |
C. elegans |
dpy-27(rh18) III; 4A;3X. Show Description
Non-Dpy 4A;3X hermaphrodites segregating 4A;3X hermaphrodites, 4A;2X males and dead or very dumpy 4A;4X hermaphrodites. Reference: Strain 19 in Hodgkin (2002) PMID: 12399387
|
|