Temperature sensitive. Left hand Roller and Dpy at 25C. Dpyish at 16C. Recessive.

Dpy. Recessive.

Roller. Temperature sensitive.

Temperature sensitive. Left hand Roller. Recessive. M-MATING-NO SUCCESS.

Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

DpyUnc.

Dpy. Unc. Tail whip knobbed at all stages except adult male (adult male tail tip slightly swollen).

Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- DpyUncs.

Heterozygotes are WT and segregate WT, dead eggs and DpyUncs. mcDf1 homozygotes arrest as dead eggs.

Heterozygotes are WT and segregate WT, Dpys which produce dead eggs, and DpyUncs.

Heterozygotes are WT and segregate WT, DpyUncs, and Dpys which give only dead eggs. Throws males.

Heterozygotes are WT and segregate WT, DpyUnc and dead eggs (mc1 homozygotes). mc1 is a strong loss of function mutation, but probably not null. mc1 is an embryonic lethal mutation with degeneration of hypodermal cells.

Heterozygotes are slightly Dpy, and segregate slightly Dpy mlt-7/tmIn4 heterozygotes, Dpy tmIn4 homozygotes, and mlt-7(tm1794) homozygotes (Let). Break points: In(lin-8 dpy-2) II. Covered region (Mb) 3.7 (3.1..6.7) Dpy. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.

tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Embryonic lethal. Deletion of 3081 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry dead eggs (ve832 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+.  Left flanking Sequence: GTGGGGAAAGATGCTAGACGGCTAGCTCCT; Right flanking sequence: AGGTCGTGGCGATCTTTGCAGGATTTGCTG. skpo-2 sgRNA #1: GGACTACAATGCCTGGAAAG; skpo-2 sgRNA #2: TCGAGGACCAGAATTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. ddi-1 also known as vsm-1.

ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator mitochondrial LAR-GECO in all body wall muscles.

Temperature sensitive. Partially fertile at 16C (very few progeny). Sterile at 20C and 25C. Weak Dpy at 15C. Spermatogenesis arrests at the spermatocyte stage.

Heterozygotes are WT and segregate wild-type, wild-type heterozygotes, and Sterile Dpy (spe-4 dpy-20 homozygotes). Homozygous mutants are weak Dpy and partially fertile at 15C. Sterile at 20-25C. Spermatogenesis arrests at the spermatocyte stage.

Temperature sensitive Dpy. Male/hermaphrodite mating strain. Hermaphrodites self-sterile at all temps; males fertile. Spermatids arrest with spikes in pronase; form normal pseudopods in TEA.

Temperature-sensitive. Fertile and weak Dpy at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage.

Homozygous male/hermaphrodite line. Males are fertile. Hermaphrodites are sterile, but slightly leaky producing a few progeny (at 25C - ts not tested). In pronase, spermatids from males activate to form many long spikes, terminating at this stage. A very few (1-3 per worm) activate to form normal-looking, motile spermatozoons.

Dpy. spe-6(hc163) is a recessive suppressor of spe-27(it132). spe-6(hc163) also suppresses spe-8, spe-12, spe-29 and other spe-27 alleles. Causes precocious spermatid activation. Fertile between 15-25C.

Temperature sensitive spe-27 allele. Leaky sterile at 20C. Males at 20C produce spermatids that form spikes in pronase. Males are fertile. Temperature sensitive dpy-20 allele. Maintain at 15C.

spe-6(hc163) suppresses the self-sterility of spe-29 in this strain. Self-sterile at 25C.

Heterozygotes are WT and segregate WT and Unc Rollers. sC4(s2172) is not viable as a homozygote. As a heterozygote it reduces recombination between unc-76 and rol-9 to 1.8%. Note: This strain has been sequenced and the sC4 balancer contains a large deletion from V:16,060,619 to V:19,331,432 that removes 1,279 genes and has a complex rearrangement on LGIV. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9

hyEx21 [hsp-16.2p::eff-1 + rol-6(su1006)]. muIs65 [ajm-1::GFP + dpy-20(+)]. AJM-1 marks epithelial junctions. Pick Rollers to maintain.

Heterozygotes are wild-type and segregate wild-type (heterozygotes), Dpys (dpy-21 par-4 homozygotes that lay dead eggs), and dead eggs (ozDf2 homozygotes). Maintain by picking wild-type.

Heterozygotes are WT and segregate WT, Steriles (hd43 homozygotes) and Dpy Uncs.

Dpy. Temperature sensitive. Lethal cold sensitive. Male lethal. M-MATING++ 1-10%WT.

Pick Unc hermaphrodite to maintain (these will be tra-1/+; unc-42 him-5 dpy-21 XO animals). Segregates Unc hermaphrodites (tra-1/+ III), Unc males (+/+ III), and DpyUnc hermaphrodites (+/+ III). dpy-21 not expressed in XO. dpy-21(e428) V; XX animals are weak Dpy. dpy-21(e428) V; XO animals are non-Dpy.

Hermaphrodites are Dpy and Him. Males are non-Dpy and Mab. Males have abnormal bursa and defective rays. Both sexes show lateral hypodermis lineage defexts. M-MATING+POOR <1%WT.

Variably Dpy, slow growing. Inviable on MYOB medium.

Hermaphrodites are Dpy. Males are non-Dpy and have abnormal bursae in adult, with swollen rays. Males will mate, but with very low efficiency. [3/98: King Chow isolated a line from the CGC stock that was throwing 100% Mabs. Sent the strain back to the CGC to replace the old stock.]

Hermaphrodites are Dpy and segregate males. Males are non-Dpy and Mab. Both sexes show lineage alterations.

Hermaphrodites are Dpy and segregates males. Males are non-Dpy and have severe tail abnormalities; frequently lethal to adult males.

Dpy. Severe. Semidominant. Inviable at 15C.

Severe roundheaded Dpy. Almost inviable at 15C.

Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.

Heterozygotes are WT (somewhat Unc and Egl) and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.

Heterozygotes are WT and segregate WT, DpyUnc and fertile females.

Partly or completely suppressed Dpy.

Weak suppression of dpy-20 by sup-23. Medium Dpy.

Weak suppression of dpy-20 by sup-22. Dpy phenotype, but less Dpy than dpy-20 alone.

Suppressed Dpy. e1957 previously called sup-21.

Non-Dpy 4A;3X hermaphrodites segregating 4A;3X hermaphrodites, 4A;2X males and dead or very dumpy 4A;4X hermaphrodites. Reference: Strain 19 in Hodgkin (2002) PMID: 12399387

sup-34 is dominant amber suppressor: weak suppression of Unc, medium suppression of Dpy.

Dpy hermaphrodites. Males (XO) non-Dpy. M-MATING++++ >30%WT.

Extreme Dpy suppressed to weak Dpy or non-Dpy phenotype by amber suppressor. Received new stock from J. Hodgkin 5/31/95.