More Fields
Strain Species Genotype
AA278 C. elegans dhIs59. Show Description
dhIs59 [Topo::daf-9::GFP + lin-15(+)]. Perinuclear expression in a ventral pair of bilateral neurons identified as the IL1Vs or URAVs in the anterior ganglia. By mid-L2, expression in the cytoplasm of the hypodermis, the syncitial epidermis, but absent from midline, epidermal seam cells. Levels peak around the L2 molt and diminish during L4. In some cases, transient expression seen in the L3 vulval blast cells. Also expressed within the hermaphrodite spermatheca starting in late L4 larvae and continuing eve in old adults. In males, expression in IL1V/URAVs and hypodermis but not somatic gonad. In dauer larvae, strong expression in IL1V/URAV and specifically extends into axonal but not dendritic processes. In post-dauer stages, expression in a pattern similar to reproductively growing animals, except expression is absent in the hypodermis. Grow at 20C. May still contain lin-15(n765) mutation in the background.
AA426 C. elegans dre-1(dh99) V. Show Description
Precocious fusion of seam cells one stage earlier (prior to L3 molt); impenetrant gonadal migration defects; SynMig on daf-12 RNAi.
AA699 C. elegans din-1(hd36) II. Show Description
non-Daf. Temperature-sensitive phenotypes: at 20C half of the animals are egg-laying defective with occasional mispositioned gonadal arms; at 25C, 18% arrest as embryos: those animals that hatch usually display variable morphology defects in body and pharynx; nearly all animals that live to adults are small, clear, slightly uncoordinated, constipated, and virtually sterile. Maintain at 20C or below.
AA790 C. elegans lin-15B&lin-15A(n765) X; dhEx343. Show Description
dhEx343 [din-1p::din-1E::GFP + lin-15(+)]. Pick GFP+ to maintain. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1s::GFP is detected in hypodermis, seam, intestine, and somatic gonad including the distal tip cells. din-1s is also expressed in neurons, vulval precursors, body wall muscle, pharynx, and all tissues with heterochronic phenotypes or remodeled during dauer. Expression is first detected in a few nuclei by the comma stage of embryogenesis. By hatching, din-1s was widely expressed, albeit weakly. Overall expression in most tissues is detected at various levels into adult and in dauer larvae. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1p::din-1E::GFP was produced by cloning into Fire Lab vector L3781.
ABR156 C. briggsae Cbr-she-1(v35) IV; mfIs42. Show Description
mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.
ABR161 C. elegans hjIs37; ldrIs1. Show Description
hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. mRFP targeted to peroxisomes in intestinal cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing parental strains VS10 and LIU1 and outcrossing six times to ABR lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.
ABR212 C. elegans acd-1(sta6) delm-2(ok1822) I. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4).
ABR225 C. elegans acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.
ABR339 C. elegans lpin-1(wbm76[lpin-1::GFP]) V. Show Description
GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
AC196 C. elegans sao-1(ik1) V. Show Description
Superficially wild-type. Suppresses of aph-1(zu147). Reference: Hale VA, et al. Genetics. 2012 Mar; 190(3): 1043-1057.
AD186 C. elegans egg-1(tm1071) III. Show Description
Temperature sensitive sterile. Maintain at 20C. Fertility is <10% of WT at 25C.
AD213 C. elegans spe-19(eb52) V; asEx83. Show Description
asEx83 [spe-19(+) + myo-3p::GFP]. Pick GFP+ to maintain. asEx83 contains 7.3kb genomic fragment including spe-19 (Y113G7A.10) and 850bp of upstream sequence. Transgene rescues spe-19(eb52) sperm activation defect. GFP+ hermaphrodites are fertile. non-GFP hermaphrodites are sterile. All males are fertile.
AD226 C. elegans egg-3(tm1191)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP tm1191 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.
AD266 C. elegans egg-4(tm1508) egg-5(ok1781) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1508 ok1781 homozygotes (maternal sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Parry JM, et al 2009 Current Biology 19(20):1752-7.
AD292 C. elegans spe-51(as39) IV; him-5(e1490) V; asEx95. Show Description
asEx95 [T22B11.1(genomic) + myo-3p::GFP]. Pick GFP+ animals to maintain. as39 is a non-conditional allele of spe-51. Mutant hermaphrodites and males are severely subfertile due to a sperm defect. The extrachromosomal array asEx95 effectively rescues the fertility defect. Him. Reference: Mei X, et al. Curr Biol. 2023 Jul 3;S0960-9822(23)00780-7. doi: 10.1016/j.cub.2023.06.029. PMID: 37453427.
ADS707 C. elegans unc-13(s69) I; aeaIs8; hpIs728. Show Description
aeaIs8 [ift-20p::GCaMP6s::3xNLS + lin-15(+)]. hpIs728 [gpc-1p::wCherry + lin-15(+)]. Unc. Nuclear-localized GCaMP6s expressed in ciliated sensory neurons. Cytoplasmic wCherry expression in a subset of neurons. Derived by crossing EG9631 (unc-13) hermaphrodites with ZM10104 (aeaIs8; hpIs728) heterozygous males. Reference: Lin A, et al. bioRxiv 2022.05.27.493772; doi:
AF13(4) Oscheius akosreti Oscheius akosreti wild isolate. Show Description
Isolated in Memorial Park in Madison, WI. No hermaphrodites. Lots of SDS resistant dauers. Can survive between 15-28C, but grows very slowly at 15C.
AF72 Mesorhabditis spiculigera Show Description
Mesorhabditis spiculigera. Isolated in Pennsylvania. NOTE: (06/10/2016) AF72 was originally described as Mesorhabditis miotki, but K. Kiontke has determined through morphological inspection that this is actually a strain of Mesorhabditis spiculigera.
AFS205 C. elegans zen-4(cle5) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018;
AFS222 C. elegans zen-4(cle10) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle10), GAC to AAC (D520N), and two silent mutations. One silent mutation is a CGA to CGG mutation at codon 523 that creates a recognition site for a Cas9 guide RNA, in order to use zen-4(cle10ts) as a CRISPR/Cas9 co-conversion marker. The other silent mutation is a GCA to GCT mutation at codon 519 that introduces an AluI site for RFLP analysis. Reference: Farboud B, et al. Genetics Early online November 30, 2018;
AG152 C. elegans unc-85(e1414) bli-2(e768) dpy-10(e128) II. Show Description
Unc and Dpy. Not Blistered: dpy-10 suppresses the appearance of the blisters.
AG168 C. elegans fzy-1(av15) unc-4(e120) II. Show Description
Unc. Gain-of-function allele of fzy-1.
AG247 C. elegans tyms-1(tm2429) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm2429 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).
AG248 C. elegans mus-101(tm1761) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm1761 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).
AGK192 C. elegans unc-119(ed3) III; zdIs13 IV; armIs5. Show Description
zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.
AGK233 C. elegans unc-119(ed3) III; niDf199 IV; armEx58. Show Description
armEx58 [WRM0611aH08-Del8mer + unc-119(+)]. Pick non-Unc to maintain. This strain contains a transgenic array that expresses a derivative WRM0611aH08 fosmid. The WRM0611aH08 fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. This derivative fosmid construct lacks the upstream 8-mer motif (CTGTTTCA) next to 21U-3372. The expression of this individual 21U-RNA is lost in transgenic animals. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
AGK234 C. elegans unc-119(ed3) III; niDf199 IV; armEx53. Show Description
armEx53 [WRM0611aH08 + unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. This strain contains a transgenic array that expresses the WRM0611aH08 fosmid construct. This fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. Expression of this fosmid construct in JU258 worms restores the expression of the missing 21U-RNAs in the germline, as measured by RT-qPCR. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
AGK26 C. elegans unc-119(ed3) III; armEx5. Show Description
armEx5 [zfp-1(fosmid)::GFP + unc-119(+)]. Pick non-Unc to maintain. Fosmid-based zfp-1::GFP transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. Nuclear expression of zfp-1::GFP is observed ubiquitously in somatic cells in all developmental stages; high levels of GFP expression is observed in oocytes with lower levels of expression in the distal germline. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK369 C. elegans zfp-1(ok554) III; armIs8. Show Description
armIs8 [zfp-1(short isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs8 transgene rescues the protruded vulva phenotype of zfp-1(ok554). Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK370 C. elegans zfp-1(ok554) III; armIs9. Show Description
armIs9 [zfp-1(long isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs9 transgene rescues zfp-1(ok554)/nDf17 lethality. Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK532 C. elegans unc-119(ed3) III; niDf199 IV; armEx196. Show Description
armEx196 [mex-5p::unc-130::GFP::tbb-2 3'UTR + Cbr-unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to deletion of the niDF199 locus. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
AGK537 C. elegans unc-119(ed3) III; armEx199. Show Description
armEx199 [cdl-1p::cdl-1::GFP + unc-119(+)]. Pick non-Unc to maintain. Nuclear localization of CDL-1::GFP in the germline and early embryos; strong enrichement of CDL-1::GFP in the nuclei of developing oocytes. Reference: Avgousti DC, et al. EMBO J. 2012 Oct 3;31(19):3821-32.
AH102 C. elegans lip-1(zh15) IV. Show Description
Deletion allele which removes exons 2 to 6 of lip-1 (C05B10.1). Incompletely penetrant ovulation defect.
AH142 C. elegans zhIs4 III. Show Description
zhIs4 [lip-1::GFP] III. lip-1::GFP transcriptional reporter expression is upregulated in the secondary VPCs P5.p and P7.p of early L3 animals.
AH159 C. elegans sra-13(zh13) II. Show Description
sra-13(zh13) mutants display stronger chemotaxis to limiting concentrations of isoamylalcohol and diacetyl than WT animals. Deletion allele. 396 bp of 5' promoter sequence and all but the last exon are removed; probably a null allele.
AH205 C. elegans sdn-1(zh20) X. Show Description
Slightly Unc. Variably Egl. zh20 is a deletion in sdn-1. The sequence of the breakpoint is: TTTGCTTCACAC//zh20//GTCGACAGGCAG.
AH346 C. elegans dep-1(zh34) unc-4(e120) II; lip-1(zh15) IV. Show Description
Pvl and weak Muv. Transformation of secondary to primary vulval cell fates.
AH5059 C. elegans let-23(zh131[FRT::let-23::FRT::GFP::LoxP::FLAG::let-23]) II. Show Description
CRISPR allele of endogenous let-23, which expresses let-23::GFP fusion protein and is susceptible for conditional knock-out via incorporated FRT sites with FLPase expression. Reference: Konietzka et al. 2019. Current Biology (accepted).
ALF62 C. elegans bafIs62. Show Description
bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
ALF63 C. elegans unc-119(ed3) III; bafIs63. Show Description
bafIs63 [lin-42p(mut)::GFP + unc-119(+)]. lin-42p(mut)::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+); all potential DAF-12 binding sites have been mutated. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
ALF82 C. elegans unc-119(ed3) III; daf-12(rh61rh411) X; bafIs62. Show Description
bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Array was crossed into strain ALF3 to create ALF82. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
AM138 C. elegans rmIs130 II. Show Description
rmIs130 [unc-54p::Q24::YFP]. Diffuse distribution of Q24::YFP throughout the body-wall muscle cells.
AM141 C. elegans rmIs133. Show Description
rmIs133 [unc-54p::Q40::YFP]. AM141 animals show a soluble Q40::YFP distribution in body wall muscle cells immediately after hatching. As these worms age the rapid formation of foci is observed. When they reach adulthood, AM141 animals show an entirely Q40::YFP aggregated phenotype.
AM725 C. elegans rmIs290. Show Description
rmIs290 [unc-54p::Hsa-sod-1 (127X)::YFP]. Array encodes mutated form of human SOD-1. YFP expression in body wall muscle. Array is prone to silencing; maintain by picking worms displaying typical aggregation patterns. Reference: Gidalevitz T, et al., PLoS Genet. 2009 Mar;5(3):e1000399.
AMH50 C. elegans juIs76; bec-1(ok691) IV/nT1 [qIs51] (IV;V). Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II.  Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-pharyngeal GFP bec-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
AML1 C. elegans zfIs18; zfIs42. Show Description
zfIs18 [mec-4p::ChR2::YFP]. zfIs42 [rig-3p::GCaMP3::SL2::mCherry]. Pick mCherry+ animals to maintain strong expression from zfIs42. Worm expresses light-sensitive Channelrhodopsin (ChR2) and yellow fluorescent protein (YFP) in mechanosensory neurons, ALMR/L, AVM, PLML/R, and PVM. When fed all-trans retinal, blue light stimulation (473 nm at 2 mW * mm^-2) of head induces reversals. GCaMP3 and and mCherry expression in command interneurons AVA, and nearby pharyngeal neurons I1, I4, M4, NSM. Worms were made by crossing the integrated strains QW309 and QW625. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28.
AML17 C. elegans wtfIs2. Show Description
wtfIs2 [rig-3p::Chrimson::SL2::mCherry]. Transgenic animals express light-gated ion channel Chrimson and fluorescent protein mCherry in AVA neurons as well as nearby nearby pharyngeal neurons I1, I4, M4, NSM. Worms reverse more upon exposure to red light via optogenetic activation of AVA neurons. Reference: Kumar S, et al. PLoS Biol. 2023 Sep 21;21(9):e3002280. doi: 10.1371/journal.pbio.3002280. PMID: 37733772.
AML175 C. elegans lite-1(ce314) X; wtfIs3. Show Description
wtfIs3 [rab-3p::NLS::GFP + rab-3p::NLS::tagRFP]. Worms expressing the calcium insensitive fluorescent proteins GFP and tagRFP in the nuclei of all neurons in a lite-1(ce314) background. Control strain for AML70. Reference:
AML18 C. elegans wtfIs3. Show Description
wtfIs3 [rab-3p::NLS::GFP + rab-3p::NLS::tagRFP]. RFP and GFP expression in the nuclei of all neurons. AML18 acts as a control for the calcium imaging strain AML14. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81.
AML310 C. elegans wtfIs5; wtfEx258. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. wtfEx258 [rig-3p::tagBFP::unc-54 3'UTR]. Pick BFP+ animals to maintain transgene. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons for whole brain imaging. BFP expression from rig-3 promoter allows identification of AVAL/R neurons. Reference: Hallinen KM, et al. eLife. 2021 Jul 29;10:e66135. doi: 10.7554/eLife.66135.