Strain Information
| Name | VT3500 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | wIs51 V; hbl-1(ma354) X. |
| Description | wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x2 |
| Made by | Orkan Ilbay |
| Laboratory | VT |
| Reference | http://dx.doi.org/10.1242/dev.183111 |
Sign in
or
register an account if you want to order this strain.