More Fields
Strain Species Genotype
FX19668 C. elegans tmC6 [dpy-2(tmIs1189)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::Venus. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30138 C. elegans tmC6 [dpy-2(tmIs1208)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Balancer marked with myo-2p::mCherry. Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30143 C. elegans tmC6 II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30144 C. elegans tmC6 [dpy-2(tm9710)] II. Show Description
Break points: In(sri-57 asm-1 In(ZK1240.1 F29A7.8)) II. Covered region (Mb) 4.6 (2.3..6.9) Dpy. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
RG3332 C. elegans skpo-2(ve832[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6 [dpy-2(tmIs1208)] II. Show Description
tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Embryonic lethal. Deletion of 3081 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry dead eggs (ve832 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+.  Left flanking Sequence: GTGGGGAAAGATGCTAGACGGCTAGCTCCT; Right flanking sequence: AGGTCGTGGCGATCTTTGCAGGATTTGCTG. skpo-2 sgRNA #1: GGACTACAATGCCTGGAAAG; skpo-2 sgRNA #2: TCGAGGACCAGAATTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.