Search Strains

More Fields
Strain Species Genotype Add
WRM45 C. elegans mex-3(spr5[*tn1753]) I. Show Description
Homozygous fertile; reduced brood size. mex-3(spr5) is a CRISPR/Cas9 engineered deletion removing 488 bp of the mex-3 3´UTR. Derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM49 C. elegans mex-3(spr6[*tn1753]) I. Show Description
Homozygous fertile. mex-3(spr6) is a CRISPR/Cas9 engineered deletion removing 142 bp of the mex-3 3´UTR. Derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM50 C. elegans mex-3(spr7[*tn1753]) I. Show Description
Homozygous fertile. mex-3(spr7) is a CRISPR/Cas9 engineered deletion removing 134 bp of the mex-3 3´UTR. Derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM52 C. elegans mex-3(spr9[*tn1753]) I. Show Description
Homozygous fertile; reduced brood size. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp). Derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM53 C. elegans mex-3(spr10[*tn1753]) I. Show Description
Homozygous fertile; reduced brood size. mex-3(spr5) is a CRISPR/Cas9 engineered deletion removing 190 bp of the mex-3 3´UTR. Derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM6 C. elegans sprSi6 II; unc-119(ed3) III. Show Description
sprSi6 [mex-5p::MODC PEST::GFP::H2B::glp-1 (GBM UtoC) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM7 C. elegans sprSi7II; unc-119(ed3) III. Show Description
sprSi7 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM8 C. elegans sprSi8II; unc-119(ed3) III. Show Description
sprSi8 [mex-5p::MODC PEST::GFP::H2B::glp-1 (3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WRM9 C. elegans sprSi9II; unc-119(ed3) III. Show Description
sprS9 [mex-5p::MODC PEST::GFP::H2B::glp-1 (5' 3' PRE) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
WUM127 C. elegans viro-9(vir19) IV. Show Description
vir19 is a full deletion of the viro-9 locus. Orsay virus replication defective.
XA4900 C. elegans rib-2(qa4900)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
Heterozygotes are WT and segregate WT and Sterile Dpys. Homozygous rib-2(qa4900) animals give homozygous F2 animals that can develop to the adult stage but exhibit abnormal phenotypes such as egg-laying defects, increased body width, and reduced activity in movement. While the F2 qa4900 homozygotes are fertile, the F3 qa4900 homozygous progeny stop developing during gastrulation and fail to develop normally. 511 bp deletion in the region of intron2 to exon 6 of the rib-2 gene (K01G5.6).
XA6902 C. elegans pha-1(e2123) III; qaEx6902. Show Description
qaEx6902 [ftn-1p(delta63)::pes-10::GFP-his + pha-1(+)]. Wild type. Segregates WT and arrested L1 progeny. Maintain at 20-24C.
XA7400 C. elegans glc-3(ok321) V. Show Description
ZC317.3 Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Length: 2746. Estimated Deletion Size: 1200. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/
XA7401 C. elegans R09B5.11(ok1759) V. Show Description
R09B5.11 Homozygous. Outer Left Sequence: ctgtcgcaagtcctgattga. Outer Right Sequence: gtttccggaacaaacttcca. Inner Left Sequence: gaacgagtgtttctgggacg. Inner Right Sequence: atgaggaaggcgtactggtg. Inner Primer PCR Length: 3113. Deletion size: 1273 bp. Left flank: TATCAGTTTGAAGAGGCACTCGAAAACCTT. Right flank: ACTGTTCTATATATAAGCTGAAGTTCAACC. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/
XE2260 C. elegans casy-1(wp78) II. Show Description
wp78 is a CRISPR/Cas9-engineered 11.5 kb deletion removing the entire coding region of casy-1, the C. elegans homolog of calsyntenin. casy-1(wp78) phenocopies the casy-1(wp60) point mutation and strongly suppresses PVQ degeneration in both ric-7(n2657) and miro-1(wy50180); mtx-2(wy50266) mutants. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
XE3354 C. elegans unc-40(wp221) zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. wp221 is a CRISPR-engineered deletion of unc-40 exon 14.5 near the splice sites of exons 14 and 15. mec-4p::GFP is expressed in touch neurons. Reference: Weinreb A, et al. Nat Commun. 2025 May 16;16:4508. doi: 10.1038/s41467-025-58293-5. PMID: 40379606.
XR1 C. elegans abl-1(ok171) X. Show Description
1.5 kb of M79.1 locus is deleted which corresponds to the elimination of exons 8-12, including the kinase domain and 2/3 of the SH2 domains.
XY1054 C. elegans cep-1(lg12501) I. Show Description
1213 bp deletion corresponding to bp 30458-31670 on cosmid F52B5. Takes out a large part of the cep-1 open reading frame.
YA911 C. elegans ypT34 (III;X). Show Description
X-autosome chromosome fusion. IIIL and XR telomeres are fused. Generated in a trt-1(ok410); lig-4(tm750) mutant N2 background. Although outcrossed, ok410 or tm750 deletions might still be present in the background. Reference: Lowden M, et al. Genetics. 2008 Oct;180(2):741-54. doi: 10.1534/genetics.108.089920. PMID: 18780750.
YHS2 C. elegans cdc-25.1(bn115) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim J, et al. (2009) Mol Cell 28:43-8.
YK31 C. elegans tbx-9(ms31) III. Show Description
Deletion of 3.0 kb of the genomic region that extends from 2.1 kb upstream to the middle of the tbx-9 gene. Incompletely penetrant morphogenic defects in embryogenesis. Failure in proper formation of hypodermis and body-wall muscle.
YL139 C. elegans meg-1(vr10) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: AGATGCCACATACAAACGCT / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
YL140 C.elegans meg-1(vr11) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: CAGTTCCAAATGAATCAAAG / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
YL585 C. elegans oef-1(vr25) IV. Show Description
vr25 is a Crispr/Cas9-induced 56 bp deletion in exon 2 of oef-1/F49E8.2 causing a frameshift and presumptive null allele. Accelerated rate of germ cell progression, precocious Z2/Z3 division in L1s, increased brood size and sperm generation, and increased germline apoptosis. Reference: McManus, CE & Reinke, V. Genetics. 2017; https://doi.org/10.1534/genetics.117.1123.
YS2 C. elegans cbp-1(bm1) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys2 is an internal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA1000 cbp-1(ys2) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
YS4 C. elegans cbp-1(bm2) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys4 is an N-terminal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA990 cbp-1(ys4) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
ZB1028 C. elegans crt-1(bz29) V. Show Description
Probably null calreticulin. W28 amber. Slow growth (one day developmental delay). Nearly sterile if raised at 25C. Suppresses mec-4(d)-induced neurodegeneration. Bent-head.
ZB1029 C. elegans crt-1(bz30) V. Show Description
Probably null W231opa. Probably null calreticulin - slow growth (one day developmental delay). Nearly sterile if reared at 25C. Suppresses mec-4(d)-induced neurodegeneration. Bent-head.
ZE1 C. elegans F53B2.5(ok226) Show Description
Homozygotes are viable and do not show any gross abnormalities. Grows normally at all temperatures. Deletion removes 1505 bp including the first 4 exons.
ZF1092 C. sp. 25 Show Description
Isolated by Adeline Seah and Takao Inoue from a rotten fruit in an urban garden in Singapore (1.32°N, 103.82°E) on 7/19/2006.
ZF1222 C. sp. 25 Show Description
Isolated by Adeline Seah and Takao Inoue from a rotten fruit in an urban garden in Singapore (1.45°N, 103.72°E) on 7/19/2007.
ZG31 C. elegans hif-1(ia4) V. Show Description
Healthy and fertile in standard lab conditions, but unable to adapt to 1% oxygen. When hif-1(+) animals are incubated in1% oxygen, >94% will complete embryogenesis and larval development. In contrast, hif-1(ia4) mutants exhibit 66% embryonic lethality and 9% larval lethality in 1% oxygen. The requirement of hif-1 is alleviated if the oxygen level is increased to 2%. The ia4 mutation is a 1231 bp deletion of the second, third, and fourth exons, which encode much of the helix-loop-helix and PAS domains. Analysis of ESTs suggests that there are at least 4 alternatively spliced hif-1 transcripts. The ia4 deletion introduces a frameshift and a premature stop in the three longest forms.
ZH1963 C. elegans enIs59 I; unc-76(e911) V. Show Description
enIs59 [ced-1p::2xFYVE::GFP + unc-76(+)] I. ced-1p::2xFYVE::GFP is a phosphainositol PtdIns(3)P reporter expressed in engulfing cells for assaying cell corpse clearance and other membrane trafficking events. GFP expression from enIs59 is relatively low and causes the least deleterious effects to worm development. Reference: Lu N, et al. PLoS Biol. 2012 Jan;10(1):e1001245. PMID: 22272187
ZM6610 C. elegans nlf-1(hp428) X. Show Description
Fainter. hp428 is a G to A substitution that alters the 3? splice junction of the first intron resulting in a single base pair deletion in the hp428 cDNA causing a frame-shift and premature stop. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. doi: 10.1016/j.neuron.2013.01.018. PMID: 23522043.
ZM8202 C. elegans ubr-1(hp821 hp833) I. Show Description
Stiff backing. Presumptive null. This strain carries two CRISPR-engineered deletions to ensure complete knockout of ubr-1 function. hp821 is a deletion in the 5 ' end of ubr-1 and hp833 is a deletion near the 3' end of the gene. Reference: Chiturri J, et al. PLoS Genet. 2018 Apr 12;14(4):e1007303. doi: 10.1371/journal.pgen.1007303. eCollection 2018 Apr. PMID: 29649217.
ZR1 C. elegans rbr-2(tm1231) IV. Show Description
648 bp deletion (confirmed). About 80% of animals show defects in vulval development (Muv or Vul).
ZT2 C. elegans drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.
ZT29 C. elegans cec-4(ok3124) cec-5(fj58) IV. Show Description
Maintain at 20C or lower. The cec-4 cec-5 double mutant exhibits partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-4 and CEC-5 are phylogenetically similar to CEC-8. ok3124 is a 374-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-4 (F32E10.2). The ok3124 deletion can be detected by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj58 is a 398-bp deletion located in the gene region corresponding to the N-terminus of CEC-5 (F32E10.6). The fj58 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT3 C. elegans csr-1(fj54) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.
ZT31 C. elegans cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Show Description
Maintain at 20C or lower. Him. cec-4 cec-5 him-8 triple mutants exhibit partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. ok3124 deletion can be detceted by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj61 is a 444-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-5 (F32E10.6). The fj61 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT33 C. elegans cec-8(fj63) III. Show Description
No apparent phenotype. The chromodomain protein CEC-8 is phylogenetically similar to CEC-5 and CEC-4. fj63 is a 14-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-8 (Y55B1BR.3). The fj63 deletion can be detected by PCR with the following primers: GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT34 C. elegans cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV. Show Description
Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT35 C. elegans cec-8(fj63) III; cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Show Description
Maintain at 20C or lower. Him. The cec-8; cec-4 cec-5 him-8 quadruple mutant exhibits partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT46 C. elegans csr-1(fj67) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj67) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Intracellular localization of CSR-1 is abnormal in the csr-1(fj67) homozygotes. fj67 is a 60-bp in-frame deletion of the first lysine-rich region (KQKDNFILLDILLKQWAAKK) in CSR-1. The first lysine-rich region in the WT has a FokI site. The deletion can be checked by PCR with the following primers: CACCTGTGATTTTTCGGGGAAC and TGGATTCCTTTTGCTGCAACAG, followed by digestion with FokI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT58 C. elegans fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT60 C. elegans csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in this csr-1 null-mutant homozygotes. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. The inversion-based balancer in ZT60 is more amenable to producing csr-1(fj54) homozygous males than a translocation-based balancer (ZT3). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT61 C. elegans vsra-1(tm1637) I; csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in homozygous tm1637; fj54 double mutants. The vsra-1 mutation enhances the defects caused by the csr-1 mutation. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. tm1637 can be detected by PCR with the following primers: AAGCAGTTCTTCAAGACTGGTC and TTGTCCACTCGCACTTTGTG. The fj54 deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT62 C. elegans met-2(ok2307) set-25(n5021) III. Show Description
Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2.
ZT64 C. elegans csr-1(fj150) IV; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. fj150 is enhanced by the CeRep55 quadruple deletion. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT65 C. elegans him-1(e879) I; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.