| HS3750 |
C. elegans |
ieSi58 IV; osIs182 V. Show Description
ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. osIs182 [eft-3p::TIR1(F79G) + LoxP + myo-2p::GFP + rps-27p::neoR + LoxP] V. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. osIs182 is a single copy insertion of TIR1(F79G) into chromosome V (oxTi365) and expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.
|
|
| JU727 |
C. species |
Show Description
Male-female strain. Isolated on May 6, 2005 under a tree along a path between two villages in Changyang, 20 km north of Sanjiang, Guangxi, China. Does not cross with C. remanei PB4641 or JU724, nor with C. sp. PB2801. sp. 5 in Kiontke and Sudhaus Wormbook Ecology chapter.
|
|
| JU800 |
C. species |
Show Description
Male-female strain. Inbred derivative of JU727. Derived from JU727 by 20 generations of sib mating. Male/female strain. Isolated on May 6, 2005 under a tree along a path between two villages in Changyang, 20 km north of Sanjiang, Guangxi, China. Does not cross with C. remanei PB4641 or JU724, nor with C. sp. PB2801. sp. 5 in Kiontke and Sudhaus Wormbook Ecology chapter.
|
|
| KK157 |
C. elegans |
mel-9(b293) II. Show Description
Maternal effect lethal mutation. Temperature sensitive-grow at 15C. Some growth at 20C. Does not grow at 25C. Rescued by male mating.
|
|
| KK28 |
C. elegans |
unc-4(e120) mel-17(b299)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Strict maternal effect.
|
|
| KK288 |
C. elegans |
sqt-3(sc8) par-1(b274) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, RolPar (adult homozygotes lay eggs that don't hatch) and dead eggs. nT1[unc-?(n754) let-?] is dominant Unc and recessive lethal. Strict maternal effect. sc8 previously called rol-4(sc8).
|
|
| KK34 |
C. elegans |
unc-4(e120) mel-16(b298)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT.
|
|
| KK40 |
C. elegans |
mel-3(b281) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Unc-4s which give only dead eggs. Maintain by picking WT. Strict maternal effect.
|
|
| KK96 |
C. elegans |
unc-4(e120) mix-1(b285) sqt-1(sc13)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
mix-1(b285) is maternal effect lethal. Heterozygotes are WT and segregate WT, Unc-4 worms which are strong Egl, and paralyzed Dpy Uncs.
|
|
| LB21 |
C. elegans |
nuo-1(ua1)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT and segregate WT (fluorescent), Dpys (highly fluorescent) and L3 lethals (non-fluorescent). GFP semi-dominantly expressed in 4-60 cell embyros, pharyngeal muscle and gut. Pharyngeal and gut GFP is easily seen in a UV dissecting microscope; early embryonic signal requires higher magnification. mIs14 occasionally crosses off mIn1[dpy-10], apparently by double recombination. mIs14 is ccEx9747 integrated into mIn1[dpy-10]. This is a three-construct element containing myo-2 and pes-10 promoters and a gut enhancer fused individually to GFP coding sequence. Called LB21B.
|
|
| LB25 |
C. elegans |
nuo-1(ua1) II; unc-119(ed3) III; uaEx25. Show Description
uaEx25 [(p016bA352V) nuo-1(+) + unc-119(+)]. Contains extrachromosomal nuo-1(A352V) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of the transgene. Low brood size. Short life span. Sensitive to oxidative stress.
|
|
| LB26 |
C. elegans |
nuo-1(ua1) II; unc-119(ed3) III; uaIs26. Show Description
uaIs26 [(p016bT434M) nuo-1(+) + unc-119(+)]. Carries integration of nuo-1(T434M) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of transgene. Site of integration unknown. Moderate brood size. Shorter life span. Sensitive to oxidative stress.
|
|
| LB27 |
C. elegans |
nuo-1(ua1) II; unc-119(ed3) III; uaEx27. Show Description
uaEx27 [(p016bA443F) nuo-1(+) + unc-119(+)]. Contains an extrachromosomal array carrying nuo-1(A443F) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of transgene. Low brood size. Short life span. Sensitive to oxidative stress.
|
|
| MP108 |
C. elegans |
ndg-4(lb108) III; bus-1(lb201) V. Show Description
lb108 is inseparable from dpy-17(e164). Brood size is less than 25% of wild type. Eggs display a variable pale color. 70-95% of adults survive overnight incubation with 0.5 ug/ul nordihydroguairetic acid.
|
|
| MQ415 |
C. elegans |
age-1(hx546) rrf-3(b26) II; gro-1(e2400) III. Show Description
Slow growing. Not fertile at 25C. Daf-c at 27C.
|
|
| MSB273 |
C elegans |
syIs423 V; mirIs19. Show Description
syIs423 [15xUAS::?pes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)]. mirIs19 [nlp-12p::gal-4 + unc-122p::mCherry]. Maintain animals at 25C for several generations to enhance mKate expression in DVA to make it visible with a fluorescence dissection scope. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
|
|
| MSB555 |
C elegans |
twk-16(syb2541[wrmScarlet::degron::twk-16]) X. Show Description
wrmScarlet::degron tag inserted into the N-terminus of the endogenous twk-16 locus using CRISPR. wScarlet::TWK-16 expression in DVA and some neurons around the nerve ring. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
|
|
| MT12960 |
C. elegans |
epc-1(n4076) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Uncs, Ste/Mel, and dead eggs. The epc-1(n4076) deletion removes 886 nucleotides from the epc-1 locus (Y111B2A.11). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 2014 and ends at about nt. 2899 to give the junction sequence CTTCTCTGT/CCGGCTTTA.
|
|
| MT12963 |
C. elegans |
ssl-1(n4077) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc, Ste/Mel, and dead eggs. ssl-1(n4077) deletion removes 683 nucleotides from the ssl-1 locus (Y111B2A.23). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 5075 and ends at about nt. 5757 to give the junction sequence GATATACAC/AGACCTAAT.
|
|
| MT3453 |
C. elegans |
lin-15B&lin-15A(n765) let-2(b246) X. Show Description
Temperature sensitive Muv. Temperature sensitive lethal above 20C.
|
|
| NB240 |
C. elegans |
hsr-9(ok759) I. Show Description
Reduced apoptosis after gamma-ray treatment compared to N2. Reference: Ryu JS, et al; PLoS One. (In Press).
|
|
| NB245 |
C. elegans |
aak-1(tm1944) III; aak-2(gt33) X. Show Description
Hypersensitive to oxidative stress; more sensitive to the stress than either of the cognate single mutants. Parental aak-1(tm1944) strain outcrossed 8 times; parental aak-2(gt33) strain outcrossed 3 times. Reference: Lee H, et al. J Biol Chem. 2008 May 30;283(22):14988-93.
|
|
| NFB2057 |
C. elegans |
fkh-8(vlc43) II; otIs395. Show Description
otIs395 [ift-20p::NLS::tagRFP + pha-1(+)]. Ciliome defects. CRISPR-engineered fkh-8 null mutation. Reference: Brocal-Ruiz R, et al. Elife. 2023 Jul 14;12:e89702. doi: 10.7554/eLife.89702. PMID: 37449480.
|
|
| NFB2456 |
C. elegans |
daf-19(of5) II; wgIs652. Show Description
wgIs652 [fkh-8::TY1::EGFP::3xFLAG + unc-119(+)]. CRISPR-engineered allele of daf-19 affects only isoforms a and b. De-repression of fkh-8 expression in neurons. Reference: Brocal-Ruiz R, et al. Elife. 2023 Jul 14;12:e89702. doi: 10.7554/eLife.89702. PMID: 37449480.
|
|
| NFB2468 |
C. elegans |
zdIs13 IV; vlcEx1288. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1A(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1A. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB2471 |
C. elegans |
zdIs13 IV; vlcEx1290. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
|
|
| NFB2518 |
C. elegans |
dat-1(syb4741[dat-1::T2A::NeonGreen]) III; him-8(e1489) IV. Show Description
NeonGreen tag inserted into endogenous dat-1 locus by CRISPR/Cas9 engineering. NeonGreen expression in dopaminergic neurons. Superficially wild type. Reference: Jimeno-MartÃn A, et al. Genome Res. 2022 Mar;32(3):459-473. PMID: 35074859.
|
|
| NFB2682 |
C. elegans |
him-8(e1489) IV; osm-5(syb6528[osm-5::SL2::GFP::H2B]) X. Show Description
SL2::GFP::H2B tag inserted at the C-terminus of the endogenous osm-5 locus by CRISPR. GFP expression labels ciliated sensory neurons. Him. Reference: Brocal-Ruiz R, et al. Elife. 2023 Jul 14;12:e89702. doi: 10.7554/eLife.89702. PMID: 37449480.
|
|
| NK3241 |
C. elegans |
let-2(qy289[let-2 (G1287D)::mNG]) X. Show Description
Endogenously tagged temperature sensitive glycine substitution mutant allele (b246) of let-2. Tagged with mNG at the C-terminus. Temperature sensitive embryonic lethal. Grows at 15C, 20C. Lethal at 25C (embryonic). See also CGC DH246. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NM4337 |
C. elegans |
rep-1(ok3296)/sC1(s2023) [dpy-1(s2170)] III. Show Description
rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation.
|
|
| NM4431 |
C. elegans |
rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III. Show Description
jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.
|
|
| NM5178 |
C. elegans |
jsTi1492 II. Show Description
jsTi1492 [LoxP::mex-5p::FLP::SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] II. jsTi1492 is prone to silencing; pick animals with GFP+ germlines to maintain. jsTi1492 is an RMCE landing site inserted using miniMos located on Chr II at at 3,160,571 (WB273 genome; -8.14 m.u.) inserted in a repeat region between sri-34 and fbxc-55. Insertsion site ttttttgcaaaaaagtgcagtcataTAtgtatgtaaaaaattaattgaagac with rpl-28 transcription toward sri-34. Insertion site is ambiguous but likely near the edge of sri-34 side of the repeat region. Reference: Nonet ML. Genetics. 2020.
|
|
| OH17513 |
C. elegans |
unc-86(ot1184) III; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. Show Description
Null allele of unc-86 generated by gRNAs targeted to the first and last exons, resulting in a 3202 bp deletion from -8 to +3194 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OH17514 |
C. elegans |
ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V; ceh-14(ot1185) X. Show Description
Null allele of ceh-14 generated by gRNAs targeted to the first and last exons, resulting in a 4056 bp deletion from +40 to +4096 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OH17515 |
C. elegans |
unc-30(ot1186) IV; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. Show Description
Null allele of unc-30 generated by gRNAs targeted to the first and last exons, resulting in a 5168 bp deletion from -37 to +5131 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OS13059 |
C. elegans |
ieSi57 II; osm-6(syb2906[osm-6::linker::GFP::AID]) V. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. Endogenous osm-6 locus tagged with GFP and AID allows for inducible cilia disruption upon application of auxin. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.
|
|
| OS13359 |
C. elegans |
osm-6(syb4401[osm-6::linker::AID *syb2906]) V; vap-1(ns831[vap-1::sfGFP]) X. Show Description
Endogenous osm-6 locus tagged with AID allows for inducible disruption of cilia in the presence of TIR1 and application of auxin. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.
|
|
| PB201 |
C. remanei |
Cre-unc(bd201). Show Description
Male-female strain. Parental strain is C. remanei ssp. vulgaris. Males and females back poorly, forward movement unaffected. Males are able to mate. Autosomal. Based on phenotype alone (defective in backward movement), it might be orthologous to unc-4. See WBPaper00002633.
|
|
| PB206 |
C. remanei |
Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from the Wright State University Biology Preserve, Dayton Ohio. Species ID confirmed by mating test with EM464.
|
|
| PB212 |
C. remanei |
Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from the Wright State University Biology Preserve, Dayton Ohio. Species ID confirmed by mating test with EM464.
|
|
| PB219 |
C. remanei |
Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from Cox Arboretum, Dayton Ohio. Species ID confirmed by mating test with EM464.
|
|
| PB227 |
C. remanei |
Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from Taylorsville MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.
|
|
| PB228 |
C. remanei |
Show Description
Male-female strain. From association with a terrestrial isopod, Armadillidium vulgare, that was collected from Eastwood MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.
|
|
| PB229 |
C. remanei |
Show Description
Male-female strain. From association with a terrestrial isopod, Cylisticus convexus, that was collected from Englewood MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.
|
|
| PB2801 |
C. brenneri |
Show Description
Male-female strain. This is a 20X inbred (one gravid female per generation) derivative of LKC28, which is conspecific with CB5161. This is the strain that will be used for genome sequencing by Erich Schwarz/John Spieth. sp. 4 in Kiontke and Sudhaus Wormbook Ecology chapter.
|
|
| PHX2015 |
C. elegans |
ceh-58(syb2015[ceh-58::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-58 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX209 |
C. elegans |
R12G8.1(syb209) V. Show Description
Complete CRISPR/Cas-9 knock-out (1143bp deletion) of the gene R12G8.1. Homozygous. Superficial wild-type.
Primers for crossing:
Fwd: agctccggggacatcaaata
InFwd: CTGAAAACTCGTCGTAGCCG
Rev: tcagaggtccgtggttcaaa
Wild-type bands: 402bp, 1427bp. Mutation band: 284bp.
|
|
| PHX2171 |
C. elegans |
set-2(syb2085)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
Maintain at 20C or cooler. qIs26 [lag-2::GFP + rol-6(su1006)]. set-2 mutation balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and set-2(syb2085) homozygotes (Mrt phenotype at 25C -- viable but homozygotes will become sterile in successive generations). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. set-2(syb2085) mutant animals that express a catalytically inactive form of SET-2, the C. elegans SET1 homolog. set-2(syb2085) homozygotes are not long-lived on OP50. Reference: Caron M, et al. Life Sci Alliance. Dec 2021, 5 (3) e202101140; DOI: 10.26508/lsa.202101140. PMID: 34893559.
|
|
| PHX2172 |
C. elegans |
sin-3(syb2172) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Maternal effect sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP syb2172 homozygotes (maternal effect sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. syb2172 is CRISPR-engineered deletion removing the ATG start codon and entire sin-3 coding region. Reference: Robert VJ, et al. Development. 2023 Oct 17;150(21):dev201755. doi: 10.1242/dev.201755 PMID: 37818613.
|
|
| PHX2193 |
C elegans |
flp-11(syb2193[flp-11::SL2::mKate2::linker::twk-18(e1913)]) X. Show Description
twk-18(e1913) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes very strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|