Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
DQM104 C. elegans bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. CRISPR/Cas9-mediated recombination was used to insert eef-1a.1p::GFP into the standard MosSCI insertion site ttTi4348. Reference: Reference: Costa DS, et al. Development. 2023 May 1;150(9):dev201570. doi: 10.1242/dev.201570. PMID: 37039075.
HBR3216 C. elegans lgc-38(goe13[flp-11p::XCaMP-R::flp-11 3’UTR] *syb2346) III; flp-11(syb6321[flp-11::sfGFP] *syb714) X. Show Description
sfGFP tag inserted at C-terminus of endogenous flp-11 locus. FLP-11sfGFP translational reporter is visible in RIS and together with XCaMP-R allows visualization of RIS activity and FLP-11 release. [syb6321 sgRNA1: GCTACCATAGGCACCACGAGCGG.] [goe13 dpy-10 crRNA: Gctaccataggcaccacgag. trRNA: aacagcauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.] Reference: Park B, et al. Sci Adv. DOI: 10.1126/sciadv.adv8387 PMID:
IYR43 C. elegans plk-1(lt18[plk-1::sfGFP::LoxP]) III; dyn-1(luv35) X; bsIs20. Show Description
bsIs20 [tbb-1p::mCherry::tbb-2::tbb-2 3′UTR + unc-119(+)]. Maintain at 20C or lower. dyn-1(luv35) is a CRISPR-engineered mutation reproducing the dyn-1(ky51) allele. GFP inserted at the C terminus of endogenous plk-1 locus. At 26C, embryos exhibit elevated centrosomal PLK-1::sfGFP levels, persistence of PLK-1::sfGFP at centrosomes during late mitosis, and mild defects in intercellular bridge (midbody) assembly. Strain expressing mCherry::tubulin and endogenously tagged PLK-1::sfGFP enables live imaging of spindle dynamics and centrosomal PLK-1 localization during mitosis in embryos. Reference: Dierlam C, et al. Mol Biol Cell. 2026 Apr 1;37(4):br10. doi: 10.1091/mbc.E25-07-0337. PMID: 41705964.
IYR44 C. elegans plk-1(lt18[plk-1::sfGFP::LoxP]) III; bsIs20. Show Description
bsIs20 [tbb-1p::mCherry::tbb-2::tbb-2 3′UTR + unc-119(+)]. GFP inserted at the C terminus of endogenous plk-1 locus. Strain expressing mCherry::tubulin and endogenously tagged PLK-1::sfGFP enables live imaging of spindle dynamics and centrosomal PLK-1 localization during mitosis in embryos. Reference: Dierlam C, et al. Mol Biol Cell. 2026 Apr 1;37(4):br10. doi: 10.1091/mbc.E25-07-0337. PMID: 41705964.
JDW182 C. elegans bmdSi15 lmn-1(wrd39[lmn-1::1xGFP11]) I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. GFP11 tag inserted into endogenous lmn-1 locus via CRISPR/Cas9 insertion into parental strain DQM104. Reference: Gregory EF, et al. MicroPubl Biol. 2023 Dec 13:2023:10.17912/micropub.biology.001022. doi: 10.17912/micropub.biology.001022. eCollection 2023. PMID: 38152058.
JK5535 C. elegans glp-1(q46) III; qSi246 IV. Show Description
qSi246 [glp-1::sfGFP + Cbr-unc-119(+)] IV. Mos insertion of sfGFP tagged GLP-1 in glp-1(0) background. qSi246 rescues glp-1(q46) sterile phenotype. Animals are fertile, superficially wild-type with GFP+ distal germ-lines. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JK5896 C. elegans qSi369 II; unc-119(ed3) III; qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superficially wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. qSi370 can be prone to silencing, especially after severe starvation; silencing of GFP or mCherry expression can occur independently of one another. Maintain by picking animals with bright GFP and mCherry expression. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5932 C. elegans sygl-1(q828) I; qSi369 II; qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superfically wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5943 C. elegans qSi369 II; glp-1(q224) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ heterozygotes, non-GFP pharynx q224 homozygotes (Glp sterile at 20-25C) and dead eggs (hT2 homozygotes). All animals are sfGFP + in the germline, with distal and proximal transcription sites in the nucleus. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
NK2756 C. elegans qyIs562. Show Description
qyIs562 [zmp-1p::zmp-1sp::sfGFP::KDEL]. Anchor cell specific expression of KDEL ER lumen marker. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
NK2990 C. elegans qySi205; qyIs562. Show Description
qySi205 [lin-29p::icmt-1::mscarlet] I. qyIs562 [zmp-1p::zmp-1sp::sfGFP::KDEL]. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and anchor cell specific expression of KDEL ER lumen marker. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
OH14099 C. elegans him-5(e1490) V; otIs630 X. Show Description
otIs630 [srg-13::BirA::nrx-1 + inx-18p::AP::nlg-1 + unc-122::streptavidin::2xsfGFP + inx-18p::wCherry + rol-6(su1006)] X. Rollers. Trans-synaptic labeling of PHA to AVG synapses (iBLINC). AVG process is labeled with mCherry. Reference: Oren-Suissa M, et al. Nature. 2016; 533:206-211. PMID: 27144354
OS11927 C. elegans vap-1(ns831[vap-1::sfGFP]) X. Show Description
sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.
OS12566 C. elegans dgs-1(ns942) IV; oyIs51 V; vap-1(ns831[vap-1::sfGFP]) X. Show Description
oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. dgs-1(ns942) is a presumptive partial loss of function allele. dgs-1 loss of function causes VAP-1::sfGFP accumulation. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.
OS12876 C. elegans dgs-1(ns984) IV; vap-1(ns831[vap-1::sfGFP]) X; oyIs51. Show Description
oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. dgs-1 loss of function causes VAP-1::sfGFP accumulation. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.
OS13359 C. elegans osm-6(syb4401[osm-6::linker::AID *syb2906]) V; vap-1(ns831[vap-1::sfGFP]) X. Show Description
Endogenous osm-6 locus tagged with AID allows for inducible disruption of cilia in the presence of TIR1 and application of auxin. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.
PHX5321 C. elegans bli-4(syb5321[bli-4::SfGFP(int)]) I. Show Description
bli-4 translational reporter. SfGFP inserted in endogenous locus in 3rd exon of BLI-4 between Pro and peptidase domains. CAGCAGCCACAGTCTCCACGAGAA -> CAGCAGCCACAG^TCTCCACGAGAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
PHX6983 C. elegans fig-1(syb6983) V; vap-1(ns831[vap-1::sfGFP]) X; oyIs51. Show Description
oyIs51 [srh-142::RFP]. ADF neurons are marked with RFP. sfGFP tag inserted at C-terminus of endogenous vap-1 locus. VAP-1::sfGFP can be used as a reporter for AMsh glia secretion. fig-1(syb6983) is an engineered deletion removing teh fig-1 coding sequence. fig-1 loss of function causes VAP-1::sfGFP accumulation and dye filling defects. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.
PHX7022 C. elegans wrt-10(syb7022[wrt-10::sfGFP]) II. Show Description
sfGFP tag inserted into endogenous wrt-10 locus using CRISPR/Cas9. Tagged inserted at C-terminus immediately preceding the stop codon. Reference: Serra ND, et al. 2024 Development. Aug 7;227(4):iyae081. doi: 10.1093/genetics/iyae081. PMID: 38739761.
PHX7064 C. elegans grl-2(syb7064[sfGFP::grl-2]) V. Show Description
sfGFP tag inserted into endogenous grl-2 locus using CRISPR/Cas9. Tag inserted immediately following the signal peptide. Reference: Serra ND, et al. 2024 Development. Aug 7;227(4):iyae081. doi: 10.1093/genetics/iyae081. PMID: 38739761.
PHX7231 C. elegans fig-1(syb7231[fig-1::sfGFP]) V. Show Description
sfGFP tag inserted at C-terminus of endogenous fig-1 locus. Reference: Varandas KC, et al. Nat Commun. 2025 Jan 2;16(1):79. doi: 10.1038/s41467-024-55674-0. PMID: 39747235.
PMD300 C. elegans nhr-49(syb9651[sfGFP::nhr-49c]) I. Show Description
sfGFP tag inserted at the N-terminus of the endogenous NHR-49 gene (long isoform c). Derived by out-crossing parental strain PHX9542. Reference: Tatge L & Douglas PM. MicroPubl Biol. 2025 Aug 1. doi: 10.17912/micropub.biology.001655.
SHX3908 C. elegans C42D4.3(zju273[C42D4.3::8xMS2]) IV; zjuEx2144. Show Description
8xMS2 tag inserted at C-terminus of endogenous C42D4.3 locus. zjuEx2144 [semo-1p::MCP::24xSuntag + col-19p::scFv::sfGFP + ttx-3p::RFP]. Pick ttx-3::RFP+ animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. zjuEx2144 transgene expression provides MS2 coat protein (MCP) fused to 24xSuntag and scFv tagged with GFP. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.
SHX3909 C. elegans mai-1(zju271[mai-1::8xMS2]) X; zjuEx2144. Show Description
8xMS2 tag inserted at C-terminus of endogenous mai-1 locus. zjuEx2144 [semo-1p::MCP::24xSuntag + col-19p::scFv::sfGFP + ttx-3p::RFP]. Pick ttx-3::RFP+ animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. zjuEx2144 transgene expression provides MS2 coat protein (MCP) fused to 24xSuntag and scFv tagged with GFP. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.
SHX4319 C. elegans zjuEx2429. Show Description
zjuEx2429 [col-19p::BFP::8xMS2 + semo-1p::MCP::24×Suntag + col-19p::scFv::sfGFP + myo-2p::GFP]. Pick GFP+ (pharynx) animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026.
UP3648 C elegans lpr-1(cs249[lpr-1::sfGFP::3xFLAG]) I. Show Description
sfGFP::3xFLAG tag inserted at C-terminus of endogenous lpr-1 locus using CRISPR/Cas9. 3x outcrossed with hT2[qIs48]/+ males; qIs48 was used as a visible marker to identify cross progeny. Reference: Belfi AC, et al. Development. 2026 Aug 15;153(16):dev205309. doi: 10.1242/dev.205309. PMID: 41294099.
UP3666 C. elegans lpr-3(cs250[ssSfGFP::lpr-3]) X​. Show Description
Endogenous lpr-3 locus tagged with ssSfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.
UP3715 C elegans scav-2(cs256[scav-2::sfGFP]) III. Show Description
sfGFP::3xFLAG tag inserted at C-terminus of endogenous scav-2 locus using CRISPR/Cas9. Reference: Belfi AC, et al. Development. 2026 Aug 15;153(16):dev205309. doi: 10.1242/dev.205309. PMID: 41294099.
UP3746 C. elegans let-653(cs262[let-653::SfGFP]) IV. Show Description
Endogenous let-653 locus tagged with SfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.
UP3755 C elegans ptr-4(cs264[ptr-4::sfGFP]) X. Show Description
sfGFP tag inserted at C-terminus of endogenous ptr-4 locus using CRISPR/Cas9 SEC/SapTrap method. gRNA: tttctagagtcggggtgaaa Reference: Cohen JD, et al. Genetics. 2021 Nov 5;219(3):iyab132. doi: 10.1093/genetics/iyab132. PMID: 34740248.
XW13734 C. elegans unc-76(e911) V; qxIs612. Show Description
qxIs612 [hsp-16.2p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + hsp-16.41p::nuc-1::sfGFP::mCherry::unc-54 3'UTR + unc-76(+)]. Heat-shock inducible NUC-1::sfGFP::mCherry fusion transgene for monitoring lysosomal activity. Array contains p76-16B, a plasmid containing 10.5 kb genomic DNA including unc-76. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5. doi: 10.1016/j.devcel.2019.10.020. PMID: 31735670.
XW18042 C. elegans qxIs722 II. Show Description
qxIs722 [dpy-7p::dpy-7::SfGFP (single copy)]. qxIs722 is a single copy insertion into ttTi5605 via CRISPR/Cas9. DPY-7::SfGFP expression in cuticle over hyp7. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5.
CF4587 C. elegans muIs253 II; unc-119(ed3) III. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4588 C. elegans muIs253 muIs252 II; unc-119(ed3) III. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 and wrmScarlet1-10 (both under the control of the eft-3 promoter and the unc-54 3'UTR). [NOTE: A low level of "leaky" GFP expression from sfGFP1-10 is detected at high magnifications.] Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4592 C. elegans muIs253 II; unc-119(ed3) III; his-3(mu496[his-3::sfGFP11]) V. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628