| CB1416 |
C. elegans |
unc-86(e1416) III. Show Description
Egg-laying deficient. Lineage abnormal. Mechanosensory abnormal. M-MATING++ 1-10%WT. Serotonin def.
|
|
| CB1507 |
C. elegans |
unc-86(e1507) III. Show Description
HSN-. Egl. Mec.
|
|
| MT1853 |
C. elegans |
unc-86(n843) III. Show Description
Him. Lethargic. Mec. Egl.
|
|
| MT1855 |
C. elegans |
unc-86(n844) III. Show Description
Unc. Egl. Non-Him.
|
|
| MT1857 |
C. elegans |
unc-86(n845) III. Show Description
Unc. Non-him.
|
|
| MT1859 |
C. elegans |
unc-86(n846) III. Show Description
Unc.
|
|
| MT1862 |
C. elegans |
unc-86(n848) III. Show Description
Unc. Temperature sensitive allele.
|
|
| MT1976 |
C. elegans |
unc-86(n946) III. Show Description
HSN-. Egl. Mec.
|
|
| MT306 |
C. elegans |
unc-86(n306) III. Show Description
Bloated. Mec. Egl. Him.
|
|
| OH15227 |
C. elegans |
unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID]) III. Show Description
unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press).
|
|
| OH12734 |
C. elegans |
unc-86(n846) III; otEx5851. Show Description
otEx5851 [unc-86(fosmid)::NLS::mChopti + lin-44::YFP]. Pick YFP+ to maintain.
|
|
| MT1861 |
C. elegans |
unc-86(n847) dpy-19(e1259) III. Show Description
Unc-Lethargic. Mec. Egl. ts Dpy. n847 has a Him phenotype.
|
|
| MT9056 |
C. elegans |
nDf20 III; nDp2 [unc-86(e1416)] (III;f). Show Description
Segregates Unc-86 animals and dead eggs.
|
|
| MT1350 |
C. elegans |
lin-8(n111) II; lin-9(n112) unc-86(e1416) III. Show Description
Unc. Muv.
|
|
| MT5260 |
C. elegans |
unc-86(n946) ced-7(n1892) unc-50(e306) III. Show Description
|
|
| MT4917 |
C. elegans |
unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) III. Show Description
|
|
| MT5259 |
C. elegans |
unc-86(n946) ced-7(n1892) unc-50(e306) unc-49(e382) dpy-18(e364) III. Show Description
|
|
| AY145 |
C. elegans |
kyIs262 IV; acEx24. Show Description
kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx24 [srbc-48p::srbc-48(cDNA) + unc-122::GFP]. Maintain by picking GFP+ to maintain array. Integrated RFP expression in AWB and AWC. Bright GFP expression in coelomocytes. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971
|
|
| AY146 |
C. elegans |
kyIs262 IV; acEx25. Show Description
kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx25 [odr-1p::srbc-48::GFP]. Maintain by picking GFP+ to maintain array. Extra-chromosomal GFP expression in AWC neurons. Integrated RFP expression in AWB and AWC. acEx25 rescues srbc-48 mediated defects. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971
|
|
| CX5974 |
C. elegans |
kyIs262 IV. Show Description
kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV.
|
|
| CX6391 |
C. elegans |
syg-2(ky671) X. Show Description
Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Originally had kyEx648 [unc-86 + syg-1::GFP] in this strain, but the CGC stock does not contain the array.
|
|
| CX652 |
C. elegans |
kyIs235 V; syg-1(ky652) X. Show Description
kyIs235 [unc-86::snb-1::YFP + unc-4p::lin-10::RFP(intron) + odr-1::RFP]. Also known as unc-86::VAMP::YFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| OH10425 |
C. elegans |
otIs337. Show Description
otIs337 [unc-86(fosmid)::NLS:::YFP::H2B + ttx-3::mCherry].
|
|
| OH11620 |
C. elegans |
otIs429; otIs337. Show Description
otIs429 [pag-3(fosmid)::mChOpti + ttx-3::GFP]. otIs337 [unc-86(fosmid)::NLS:::YFP::H2B + ttx-3::mCherry].
|
|
| OH12737 |
C. elegans |
uIs115; otIs14; otEx5853. Show Description
uIs115 [mec-17::RFP]. otIs14 [zig-3::GFP + rol-6(su1006)]. Rollers. otEx5853 [hsp::unc-86 + ttx-3::mCherry]. Temperature-sensitive. Maintain at 15C. Pick ttx-3::mCherry-positive animals to maintain array. Expresses unc-86 ubiquitously upon heat shock.
|
|
| OH17241 |
C elegans |
unc-86(ot1158) III. Show Description
unc-86(ot1158) is a CRISPR-engineered null allele removing the entire unc-86 coding region. Very slightly Unc. The repair ssODN is TCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGTTTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). References: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792. Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
|
|
| OH17513 |
C. elegans |
unc-86(ot1184) III; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. Show Description
Null allele of unc-86 generated by gRNAs targeted to the first and last exons, resulting in a 3202 bp deletion from -8 to +3194 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
|
|
| OP476 |
C. elegans |
unc-119(tm4063) III; wgIs476. Show Description
wgIs476 [unc-86::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
| PS3818 |
C. elegans |
unc-68(r1158) him-5(e1490) V; syEx475. Show Description
syEx475 [myo-3p::unc-68(see following comments) + myo-2p::GFP + pUC-19]. Pick GFP+ animals to maintain. myo-3p::unc-68 transgene was produced by injecting pEM23 (myo-3 promoter + unc-68 exons 1-8) + 18 kb unc-86 PCR fragment (start codon through nucleotide 18090) + pLM511 (unc-68 position 11989 to the end); fragments were recombined in vivo.
|
|
| EA90 |
C. elegans |
pag-1(ls2) dpy-17(e164) III. Show Description
Dpy. pag-1(ls2) is recessive and has not visible phenotype by itself. It increases the expression of certain lacZ fusion genes such as lacZmec-7, unc-86lacZ and unc-4unc-76lacZ.
|
|