Strain Information
| Name | PHX209 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | R12G8.1(syb209) V. |
| Description | Complete CRISPR/Cas-9 knock-out (1143bp deletion) of the gene R12G8.1. Homozygous. Superficial wild-type. Primers for crossing: Fwd: agctccggggacatcaaata InFwd: CTGAAAACTCGTCGTAGCCG Rev: tcagaggtccgtggttcaaa Wild-type bands: 402bp, 1427bp. Mutation band: 284bp. |
| Mutagen | CRISPR/Cas-9 |
| Outcrossed | x0 |
| Made by | SunyBiotech Corporation |
| Laboratory | HBR |
| Reference | Not published. |
Sign in
or
register an account if you want to order this strain.