Search Strains

More Fields
Strain Species Genotype Add
RB1483 C. elegans ifa-4(ok1734) X. Show Description
K05B2.3 Homozygous. Outer Left Sequence: atgtttcactttggcggttc. Outer Right Sequence: agagcgaataccgaagctca. Inner Left Sequence: cgagagtaattccgggttca. Inner Right Sequence: tcgcaagatggagaaggact. Inner Primer PCR Length: 2608. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1779 C. elegans fbxb-67(ok2287) I. Show Description
F49B2.2. Homozygous. Outer Left Sequence: ACAATGCAACACCCTGTCAA. Outer Right Sequence: TCACAGGTGAATGAGAAGCG. Inner Left Sequence: TATCCCAAACAGGTTGCACA. Inner Right Sequence: GGGAAATGAGCTAGAAGGGG. Inner Primer PCR Length: 2132 bp. Deletion Size: 1154 bp. Deletion left flank: CTACTCTTTGCCCCTTATTGCTCTTCTGTA. Deletion right flank: AGGTGAAAGTTTACATAGGACACCCCTTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1792 C. elegans inx-7(ok2319) IV. Show Description
K02B2.4. Homozygous. Outer Left Sequence: AGCTAGTCATGGGGAGCAAA. Outer Right Sequence: ACGTCTGAAGGTTCGTGCTT. Inner Left Sequence: GGCTGTCTTCGGAATTTTTG. Inner Right Sequence: CAAGTGCGTCGTTCATCATC. Inner Primer PCR Length: 3021 bp. Deletion Size: 1610 bp. Deletion left flank: AGTTCTGAAAATTGAAATTATTTTAAATTT. Deletion right flank: TTTTTTGACAAATCTCGGTCGATTTCCACC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1806 C. elegans fbxb-8(ok2340) I. Show Description
F49B2.1. Homozygous. Outer Left Sequence: TCGATTCGAATGGTTGTTCA. Outer Right Sequence: ACGTCATATGTGGCGCATTA. Inner Left Sequence: ACATAGGACACCCCTTGTCG. Inner Right Sequence: CCCGCATTTTTGTAGATCGT. Inner Primer PCR Length: 2880 bp. Deletion Size: 1799 bp. Deletion left flank: AGCTTCGATCACGATTCAGAGCAGTTTTGT. Deletion right flank: TCAATCCCGGCAATTTGCCGATTTACTGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1818 C. elegans C18B2.6(ok2353) X. Show Description
C18B2.6. Homozygous. Outer Left Sequence: CGTTTAAAACACACCCCACC. Outer Right Sequence: GCTCAAAATGTTGGCGTTCT. Inner Left Sequence: CAGCTCCAGTCCTCATGTCA. Inner Right Sequence: CATTTCCCGTTTCCTTTTCA. Inner Primer PCR Length: 3228 bp. Deletion Size: 2211 bp. Deletion left flank: CCGACTGTGTGACGTACTATTTCTGCGACG. Deletion right flank: AATATTCTCGAAAGGCAGATCCATGGACGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1824 C. elegans C18B2.6(ok2360) X. Show Description
C18B2.6. Homozygous. Outer Left Sequence: CGTTTAAAACACACCCCACC. Outer Right Sequence: GCTCAAAATGTTGGCGTTCT. Inner Left Sequence: CAGCTCCAGTCCTCATGTCA. Inner Right Sequence: CATTTCCCGTTTCCTTTTCA. Inner Primer PCR Length: 3228 bp. Deletion Size: 1608 bp. Deletion left flank: ATAGTATATGTCAAGTATAATTTTTCGTTT. Deletion right flank: ATGTTTCTCGTAATAGATATAAGCTGTCGT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1956 C. elegans C47B2.7(ok2572) I. Show Description
C47B2.7 Homozygous. Outer Left Sequence: ttggcgcgaaattacttttt. Outer Right Sequence: ttggaagctaaaaagccgac. Inner Left Sequence: caatatttagcgcgaaaccaa. Inner Right Sequence: aaaaaggctccaaaccttga. Inner Primer PCR Length: 1183. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1976 C. elegans uev-1(ok2610) I. Show Description
F39B2.2. Homozygous. Outer Left Sequence: GAAATGCGTACTCGCACTGA. Outer Right Sequence: GGAAAAGTTCGAGGGGAAAG. Inner Left Sequence: ACGGATTTATTCGGATGGGT. Inner Right Sequence: TACCGGGGAGAGTAAACTGG. Inner Primer PCR Length: 1301 bp. Deletion Size: 480 bp. Deletion left flank: CTTGTCCGAGAGGACTACACAGTTAGCCTT. Deletion right flank: CCGTTCGTTTCACCACCAAAGTTCACATGG. Insertion Sequence: TGCAAACGCGCTCCACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1981 C. elegans lin-23(ok2615) II. Show Description
K10B2.1 Homozygous. Outer Left Sequence: cgttttcatcgttttccgtt. Outer Right Sequence: attttatgggccaccatctg. Inner Left Sequence: caccgagcttcaacaactca. Inner Right Sequence: ctcttcgtctacgtcgcctc. Inner Primer PCR Length: 2567. Deletion size: about 1100 bp. [NOTE (08/24/2021): A user has reported that their stock of RB1981 received directly from RB appears to be heterozygous. Not known if that is also the case for CGC stock.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2056 C. elegans C45B2.1(ok2719) X. Show Description
C45B2.1. Homozygous. Outer Left Sequence: CTCGGCCACGATTTATCTTC. Outer Right Sequence: ATCGGAGTCCAGTCAGCATT. Inner Left Sequence: AAAACTTGCCGAAAACAATCT. Inner Right Sequence: TTTACACCGTCAGGCTTCAA. Inner Primer PCR Length: 1338 bp. Deletion Size: 495 bp. Deletion left flank: GCGTTCTGATTTGTCAGAAAACTGTTACAA. Deletion right flank: GTACGGACGATACGGATTCCCAGGAGGAAA. Insertion Sequence: ACCGATTCCAGCAACCATCTGCAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2065 C. elegans C45B2.1(ok2728) X. Show Description
C45B2.1. Homozygous. Outer Left Sequence: CTCGGCCACGATTTATCTTC. Outer Right Sequence: ATCGGAGTCCAGTCAGCATT. Inner Left Sequence: AAAACTTGCCGAAAACAATCT. Inner Right Sequence: TTTACACCGTCAGGCTTCAA. Inner Primer PCR Length: 1338 bp. Deletion Size: 663 bp. Deletion left flank: GGAACATACTTCCTTTGCCTTGGAATAATA. Deletion right flank: AGCGTAATCTCAACGATTTGTACGATGACT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2106 C. elegans F23B2.5(ok2781) IV. Show Description
F23B2.5 Homozygous. Outer Left Sequence: atgtgtcccgttttggatgt. Outer Right Sequence: agcgtccgaatctgaagaaa. Inner Left Sequence: cggtacttgcaaagaaggct. Inner Right Sequence: ctgcagatcgttttccgaat. Inner Primer PCR Length: 1193. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2126 C. elegans F23B2.5(ok2811) IV. Show Description
F23B2.5 Homozygous. Outer Left Sequence: atgtgtcccgttttggatgt. Outer Right Sequence: agcgtccgaatctgaagaaa. Inner Left Sequence: cggtacttgcaaagaaggct. Inner Right Sequence: cggtacttgcaaagaaggct. Inner Primer PCR Length: 1193. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2392 C. elegans F39B2.1(ok3262) I. Show Description
F39B2.1 Homozygous. Outer Left Sequence: gatccatcacgccaactttt. Outer Right Sequence: aaattcggtagatttgggca. Inner Left Sequence: gcaaggacgagttcgttgat. Inner Right Sequence: tctttggatcgtcttgaatgc. Inner Primer PCR Length: 1132. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2533 C. elegans F49B2.3(ok3512) I. Show Description
F49B2.3 Homozygous. Outer Left Sequence: ctttctcgaccaagtcgtcc. Outer Right Sequence: tacgacccgaatgctgtgta. Inner Left Sequence: aggttgggagtgggagagag. Inner Right Sequence: agaaaatcgttgatacgcgg. Inner Primer PCR Length: 1257. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2623 C. elegans F39B2.7(ok3674) I. Show Description
F39B2.7 Homozygous. Outer Left Sequence: acgttttgacagaaatcggg. Outer Right Sequence: tgacgtcattgaggcagaag. Inner Left Sequence: ggcactggaaaagagacaaga. Inner Right Sequence: acgtgctcaaaaacgaatcc. Inner Primer PCR Length: 1228. Estimated Deletion Size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB936 C. elegans src-2(ok819) I. Show Description
F49B2.5. Homozygous. Outer Left Sequence: CCCAGCGTGTCAAGTAGTCA. Outer Right Sequence: TCCCATTGGTCATCTGGAAT. Inner Left Sequence: CGATTCATGGCAGTTTAACG. Inner Right Sequence: ATTAGGTTCGCCTTTTGCCT. Inner Primer WT PCR product: 3166. Deletion size: 2426 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3397 C. elegans F59B2.14(ve897[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1106 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAAATGTCCTTAATCATGAAACTTCTT ; Right flanking sequence: GATTCATCATATGTAGCGCAAAGCCATTCA. F59B2.14 sgRNA A: ACTTTCGTCGGTTCTCTGCT; F59B2.14 sgRNA B: AACTACAAGTGGCGAAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW11656 C. elegans unc-119(tm4063) III; stIs11656. Show Description
stIs11656 [F39B2.1::H1-wCherry + unc-119(+)].
RW12232 C. elegans F39B2.1(st12232[F39B2.1::TY1::EGFP::3xFLAG]) I. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
TH65 C. elegans unc-119(ed3) III; ddIs15. Show Description
ddIs15 [C47B2.3(genomic)::YFP + unc-119(+)]. Alpha tubulin::YFP.
VC1110 C. elegans +/szT1 [lon-2(e678)] I; ptr-4(ok1576)/szT1 X. Show Description
C45B2.7. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1576 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1153 C. elegans +/mT1 II; him-10(ok263)/mT1 [dpy-10(e128)] III. Show Description
R12B2.4. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok263 homozygotes (sterile Unc). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1221 C. elegans ifa-4(ok1717) X. Show Description
K05B2.3. Superficially wild type. External left primer: ATGTTTCACTTTGGCGGTTC. External right primer: AGAGCGAATACCGAAGCTCA. Internal left primer: CGAGAGTAATTCCGGGTTCA. Internal right primer: TCGCAAGATGGAGAAGGACT. Internal WT amplicon: 2608 bp. Deletion size: 894 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1314 C. elegans F53B2.3(ok1783) IV. Show Description
F53B2.3. Superficially wild type. External left primer: AATACCGACGCATCAGGAAG. External right primer: CGTTAGTGTGGGCTTTGGAT. Internal left primer: TGGCTCATCATCAGACTTGG. Internal right primer: GATTCATGAGAGGTCTCGCC. Internal WT amplicon: 2254 bp. Deletion size: 929 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1346 C. elegans F59B2(ok1801) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F59B2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1801 homozygotes (sterile, Dpyish). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGCTCAGCAAGAAAATGAG. External right primer: GTGCTCGATGTCCACACAAC. Internal left primer: ATACCGCCTGCAATTTTCTG. Internal right primer: GCTTTTGAAATCGAAGCGAC. Internal WT amplicon: 2606 bp. Deletion size: 829 bp. Deletion left flank: TTAACAAGAAAAAATGATTTTAAAACCGTG. Deletion right flank: AAAAATTAACATGTCGAGAACCTAAGTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC141 C. elegans zif-1(gk117) III. Show Description
F59B2.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1558 C. elegans cyp-13B2(gk726) X. Show Description
K06G5.2. External left primer: TCACCCACGGACATGTAAGA. External right primer: TTTGGGCAGGTACAAACACA. Internal left primer: CTGATTGCGAGGAACAACAA. Internal right primer: GTGAACAGCGGTCTCACAAA. Internal WT amplicon: 1832 bp. Deletion size: 1291 bp. Deletion left flank: TTTGATGCCCTTTCAATGAGAAAACACCTT. Deletion right flank: AGTACAAGTAATTTCAGGTACTATCAGGAA. Insertion Sequence: AGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1595 C. elegans +/szT1 [lon-2(e678)] I; sup-12(ok1843)/szT1 X. Show Description
T22B2.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1843 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGCAGGTCAATTTCACGGTA. External right primer: CAATGAGGATGTGCAAATGG. Internal left primer: AATGTACGGCCAAGTCCAAG. Internal right primer: TATTGCTGGGACGACAATGA. Internal WT amplicon: 2626 bp. Deletion size: 1803 bp. Deletion left flank: CGCCGAACCAGTAGTTGGTGAGTTTCCTGT. Deletion right flank: CAATGATTTTACTTTTCATTCTATCCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1610 C. elegans T08B2.5(gk721) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T08B2.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk721 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATTTGGTTGAGACGATCCG. External right primer: AAGGTAACATCGCCATCGAC. Internal left primer: CGTGACATGAGATCAGGCAT. Internal right primer: GCTTGTCAAACCTCACGGAT. Internal WT amplicon: 2344 bp. Deletion size: 914 bp. Deletion left flank: GGAATTGTCTACAGTGGATGTATGAACACT. Deletion right flank: GGTTGCCATCAAATTCAAATTTCCAGGGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1641 C. elegans daf-10(gk795) IV. Show Description
F23B2.4. External left primer: TGCAATACCCCAAATTGGTT. External right primer: AGTTTGGTTGAGATCGTCCG. Internal left primer: TTATTGACGGTTCCTCGGTC. Internal right primer: GCTGATCGCCCATATCTCAT. Internal WT amplicon: 1963 bp. Deletion size: 834 bp. Deletion left flank: TTAAACTAATATTTGCGGTAAAATATGTAC. Deletion right flank: CCAAAAAAAAAAACTGTTCCCCATGGAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1684 C. elegans C34B2.8(ok2168) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C34B2.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2168 homozygotes (mid-larval arrest, thin Unc sometimes with withered tail). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTTTCATTCCACCTTCGGA. External right primer: CATCTGCTCCAACGACTTCA. Internal left primer: AACAACCGCGTCAAAAGTGT. Internal right primer: ATTCGTCTCGATTTGCTGCT. Internal WT amplicon: 2130 bp. Deletion size: 1250 bp. Deletion left flank: GACCCACCGCTCAATTTTTGTTCCTGCGCC. Deletion right flank: TTGAATGCACGATAGCCTCCTTTTGGAGGC. Insertion Sequence: AAAAGTGCGATGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1763 C. elegans F59B2.8(ok2150) III. Show Description
F59B2.8. External left primer: TATTGCCCGTGTGTGTGTTT. External right primer: ACAAGGATGCTTTACCCGTG. Internal left primer: TTCTTCGTCTCCGCACTCTT. Internal right primer: TCTCGTCTCTCACCCGTTCT. Internal WT amplicon: 2249 bp. Deletion size: 1073 bp. Deletion left flank: CTAAAATCTTTTTGGCTTTGGCTACTCCTA. Deletion right flank: CACCAGTGGTAGTTTTGTAATAGGAAACGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1909 C. elegans flp-1(ok2505) IV/nT1 [qIs51] (IV;V). Show Description
F23B2.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2505 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGTGTCCCGTTTTGGATGT. External right primer: AGCGTCCGAATCTGAAGAAA. Internal left primer: CGGTACTTGCAAAGAAGGCT. Internal right primer: CTGCAGATCGTTTTCCGAAT. Internal WT amplicon: 1194 bp. Deletion size: 475 bp. Deletion left flank: GTATACTATTCATTTAAAAAATATTGCCTA. Deletion right flank: TTTCTGATAAAAAAGAGCACAACTTGGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1979 C. elegans R12B2.3(gk3268) R12B2.2(gk3269) tbx-34(gk1051) III. Show Description
This strain is homozygous for a deletion (gk1051) in Y47D3A.10, detectable by PCR using the following primers. External left primer: AGTTGTGGCTTCTGCGAACT. External right primer: CACCCACTGACACCATTGAG. Internal left primer: ATGGTCAGGACGGGAATGTA. Internal right primer: TTTCTCCACTGCAACGTGAC. Internal WT amplicon: 2318 bp. Deletion size: 971 bp. Deletion left flank: TTTTTGTGCAGCAATTTTTGCGGCGGCTGA. Deletion right flank: GGTGTCAGTGAATGTAGGCAGCCATGAAGC. Validation: gk1051 passed by diagnostic PCR, CGH. Other deletions (gk3268, gk3269) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1996 C. elegans T08B2.4(ok2534) I. Show Description
T08B2.4. External left primer: ATTTCAACAAGAACCGCTGG. External right primer: ACACGAGTTCATATTCCGGC. Internal left primer: ACGCGCATCAGTTACAAGAA. Internal right primer: AGCCTATATCTCCGTGCGAA. Internal WT amplicon: 1244 bp. Deletion size: 478 bp. Deletion left flank: GCCCTGGCAAGGCGATGTGGAGTTGAAGAT. Deletion right flank: TGTTTTTCTTCTACTTTTGAAATTGCTCCA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2071 C. elegans F39B2.1(gk3174) I. Show Description
This strain is homozygous for a deletion (gk3174) in F39B2.1, detectable by PCR using the following primers. External left primer: CCGGTAGTAGCTTTCCCCTC. External right primer: AAGTCGCATAAGTCCATCGG. Internal left primer: ATATCAACCATCCAGCCAGC. Internal right primer: CGTCAGAATGGTACACAGCG. Internal WT amplicon: 2358 bp. Deletion size: approximately 450 bp. Validation: gk3174 passed by CGH. Left deleted probe: CATGGTCGCGACGAGGCTCAATCTGATCCATCACGCCAACTTTTGTTTAA. Right deleted probe: GATAGAATTCAACAGAATTTTTCGAGTGAGTAAGGATTTCTGGACAGTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2275 C. elegans uev-1(ok2597)/hIn1 [unc-101(sy241)] I. Show Description
F39B2.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2597 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAATGCGTACTCGCACTGA. External right primer: GGAAAAGTTCGAGGGGAAAG. Internal left primer: ACGGATTTATTCGGATGGGT. Internal right primer: TACCGGGGAGAGTAAACTGG. Internal WT amplicon: 1302 bp. Deletion size: 727 bp. Deletion left flank: TTATGGTAACACTTTGTGGCGGGACCAATC. Deletion right flank: ATGTACCACGCAATTTCCGTCTGCTGGAAG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2410 C. elegans sma-4(ok3140) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R12B2.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3140 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACGGAAAGGTGTTCCACAT. External right primer: GGTCCGTGCAGAAAATCAGT. Internal left primer: CGCAAGAATATGGAGATGGC. Internal right primer: TGCTCGTACTGCTTCATTGC. Internal WT amplicon: 1288 bp. Deletion size: 718 bp. Deletion left flank: AGAGGTGGCTGCTCTCTCTCTCTGACTTTT. Deletion right flank: TTCGTCCGATCCGGGTACCTAGACTACACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2415 C. elegans mtx-1(ok3155) I. Show Description
F39B2.11. External left primer: GATTTTGTCGTCTCGTGGGT. External right primer: CAGGATAGCAATTGGGGAGA. Internal left primer: AGTAGGTAGGGGGCAAGCAA. Internal right primer: CTTTGTTCGAAATTTTCCGC. Internal WT amplicon: 1278 bp. Deletion size: 371 bp. Deletion left flank: TCTTACCACTGCTGGATACAAATTGTGATG. Deletion right flank: CTTGAAATTCCAAATTCGGAAAAAAATCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2845 C. elegans kin-30(gk1214) V. Show Description
M01B2.1. Identified by PCR, validated by CGH. External left primer: CAAATCAGCGGAAATACGGT. External right primer: CTGCCCGCAATTAGAATGTT. Internal left primer: AAGATTCGTCCGATCTGTGG. Internal right primer: TTTAGGCCGAAGAGTTGCAT. Internal WT amplicon: 2534 bp. Deletion size: 806 bp. Deletion left flank: GATCTCAGGAGTGTTTTGAAATACACACCA. Deletion right flank: CATCATAGCAAAAAATCTTATTACAGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC320 C. elegans nrfl-1(ok297) IV. Show Description
F23B2.1. Egl with vulval blip. Lays few or no eggs. Hermaphrodites may be unmatable; male mating efficiency unknown. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3276 C. elegans F39B2.1&F39B2.12(gk3170) I; gkDf39 X. Show Description
This strain is homozygous for a deletion (gk3170) in F39B2.1 and F39B2.12, detectable by PCR using the following primers. External left primer: CCGGTAGTAGCTTTCCCCTC. External right primer: AAGTCGCATAAGTCCATCGG. Internal left primer: ATATCAACCATCCAGCCAGC. Internal right primer: CGTCAGAATGGTACACAGCG. Internal WT amplicon: 2358 bp. Deletion size: 1150 bp. Deletion left flank: GCGGTGCTTCGAATTTATTTATAACATTCA. Deletion right flank: CGCTCGTCACCACAGCGGTGAGAAGGTGCT. Validation: gk3170 passed by CGH. Other deletion (gkDf39) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4774 C. elegans C34B2.4(gk5842[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1188 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CATTTCTTTCAAAACAAGGCTAATACATAT. Right flanking sequence: AAATGATAAACAAAGAAAAACTTCCAAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC558 C. elegans frk-1(ok760) IV/nT1 [qIs51] (IV;V). Show Description
T04B2.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok760 homozygotes (probable early larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC703 C. elegans ani-2(ok1147)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
K10B2.5. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1147 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC736 C. elegans gfl-1(gk321) IV. Show Description
M04B2.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC745 C. elegans gfl-1(ok1046) IV/nT1 [qIs51] (IV;V). Show Description
M04B2.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1046 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC769 C. elegans +/szT1 [lon-2(e678)] I; ifa-1(ok1257)/szT1 X. Show Description
F38B2.1a. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, lon-2 males, arrested szT1 aneuploids, and ok1257 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC820 C. elegans kbp-5&tag-272(ok1358) I. Show Description
C34B2.2, C34B2.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807