Search Strains

mNeonGreen and AID* tags inserted into endogenous ceh-13 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.

mNeonGreen::3xFLAG::AID* tags inserted into endogenous egl-5 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.

Molecular null allele. syb2457 is a CRISPR-engineered deletion of the entire dmsr-7 coding region. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

ReaChR expressed in RIS for optogenetic activation. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.

Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-86 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.

Superficially wild-type. Deletion removes of wac-1.1/Y40B1A.1 and wac-1.2/Y40B1A.3 (I:13344075 to 13358647, version WS276, PRJNA13758).

GFP tag inserted at the C-terminus of the endogenous ceh-13 locus by CRISPR. Reference: Murray JI, et al. PLOS Genet. 2022 May 2;18(5):e1010187. PMID: 35500030

Endogenous ins-9 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

GFP tag inserted at the C-terminus of the endogenous flp-3 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Tekieli T. et al. Development. 2021 Sep 15;148(18):dev199687. doi: 10.1242/dev.199687. PMID: 34415309.

GFP tag inserted at the C-terminus of the endogenous flp-1 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Taylor SR, et al. Cell. 2021 Aug 5;184(16):4329-4347.e23. doi: 10.1016/j.cell.2021.06.023. PMID: 34237253.

mCherry tag inserted into the endogenous ikb-1 locus. IKB-1::mCherry is observed in the pharynx and body wall muscles during development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.

GFP tag inserted at the C-terminus of the endogenous nob-1 locus by CRISPR. Reference: Murray JI, et al. PLOS Genet. 2022 May 2;18(5):e1010187. PMID: 35500030

Endogenous ins-6 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

Endogenous nlp-50 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.

GFP tag inserted at the C-terminus of the endogenous nlp-51 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Taylor SR, et al. Cell. 2021 Aug 5;184(16):4329-4347.e23. doi: 10.1016/j.cell.2021.06.023. PMID: 34237253.

T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous ric-4 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

GFP tag inserted at the C-terminus of the endogenous ceh-16 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

Increased lethargus duration and increased movement quiescence during lethargus. syb293 is a clean C-terminal deletion starting from the same position where nas-38(ok3407) is truncated, removes a large part of the TSP domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

flp-11p::unc-58(e665) was knocked into a SKI LODGE site to express a sodium channel in RIS that causes moderate over activation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.

T2A::3xNLS::GFP tag inserted at the C-terminus of the endogenous unc-10 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095

(III:7007600). FLP D5 recombinase driver expressed from the flp-11 promoter. The flp-11p::FLP driver consistently causes recombination in RIS, as well as in several other cell types. It is more penetrant but less specific than srx-9(syb7929[srx-9::SL2::FLP D5]). Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

FLP D5 recombinase expressed from the srx-9 locus. The srx-9::SL2::FLP driver caused recombination in RIS in most of the individuals, with no recombination detected outside of RIS. It is less penetrant but more specific than syb2346 syb6265[flp-11p::FLP D5::flp-11 3’UTR]. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

Bacteria. E. coli harboring the plasmid PB255, which uses the lin-31 promoter variant to express the lin-31::VP16 chimeric gene. It is particularly useful for the expression of heterologous genes in the vulval precursor cells. PB255 possesses three main components : an enhancer, a promoter region, a multi-cloning site (MCS), and a 3' UTR derived from the unc-54 gene. [CGC note: The plasmid in this strain was constructed from pBS II KS(+) and is likely Amp-R, but Amp-R has not been confirmed]. Biosafety Level: BSL-1.

Male-female strain. Low fecundity and fitness. PX439 is an inbred derivative of isofemale line PB259 originally collected from a forest in Ohio (USA) by Scott Baird (Wright State University). Reference: Fierst JL, et al. PLoS Genet. 2015 Jun 26;11(6):e1005323. doi: 10.1371/journal.pgen.1005323. PMID: 26114425.

Y111B2A.19 Homozygous. Outer Left Sequence: attttcggtaatttgccggt. Outer Right Sequence: aaaattacgctccgcctctt. Inner Left Sequence: tctgccagtttgctggaaat. Inner Right Sequence: tgcgcgacgctacttataga. Inner Primer PCR Length: 3222. Deletion size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E04F6.3, E04F6.6. Homozygous. Outer Left Sequence: AACGATGGAGAGGAAACGTG. Outer Right Sequence: TGAACCACGTCCAGAAGATG. Inner Left Sequence: GGACGGTCATTGTTATCTCTTG. Inner Right Sequence: CGGTGGGAATAAGACAGAGG. Inner Primer PCR Length: 3145 bp. Deletion Size: 2110 bp. Deletion left flank: ATACTTTTTTTGCAAATTATTTAAAACATC. Deletion right flank: AGTAAAACCATTCAAATATAATATAAATTC. Insertion Sequence: AGTAAAAACGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52E10.3. Homozygous. Outer Left Sequence: TCGGACTCCTGTTCGCTAGT. Outer Right Sequence: TGGCAGTTTCTCTTCTCCGT. Inner Left Sequence: CAACGGGCATCTTTGTAATCT. Inner Right Sequence: GGATTTATGGCTCTCACCCA. Inner Primer PCR Length: 1229 bp. Deletion Size: 533 bp. Deletion left flank: GTGGAAATTCGTTTTCAGTAGGGCGTATTT. Deletion right flank: TAATATTTTTAAATTCAAGTTATAAGCATT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41E7.2 Homozygous. Outer Left Sequence: aatgccaactatgattcgcc. Outer Right Sequence: tctcgcggatacaaagacct. Inner Left Sequence: aagaacagggaatcggaacc. Inner Right Sequence: ttctctcctcgttccacctc. Inner Primer PCR Length: 3078. Deletion size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48E1A.1. Homozygous. Outer Left Sequence: TTCAGCTTTGAAATTTCCGC. Outer Right Sequence: GCCATTTTGGGCAATAAAAA. Inner Left Sequence: CTCCGTCGTCTGATCCTCTC. Inner Right Sequence: TTCAGGAATGAGATCCCTCG. Inner Primer PCR Length: 2607 bp. Deletion Size: 1490 bp. Deletion left flank: CAGTTTCAATTCCCGCTGCCATATTTCCCT. Deletion right flank: TTTTGTCTCAGAAAATCCGCATTTTTTGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35C5.6. Homozygous. Outer Left Sequence: ACACCCATCAGTCCTTCCTG. Outer Right Sequence: ACCAAAACATGCCTACCTGC. Inner Left Sequence: GGTGTTATCAGTGATGGGGG. Inner Right Sequence: TACCCCAGATATGTCCGAGC. Inner Primer PCR Length: 2202 bp. Deletion Size: 823 bp. Deletion left flank: AATTTCTGAAGATCAGACAAAAATAGAGAG. Deletion right flank: TTGGATGGCAGAACATCAACGCATACAGTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28F2.7. Homozygous. Outer Left Sequence: CGTCGATTCCAGTAATCCCA. Outer Right Sequence: CATTCATCTGCATGGACACC. Inner Left Sequence: CGCAGCTAGAGTTTCACAGC. Inner Right Sequence: CAGAGCTTTAACATTGAGATGCC. Inner Primer PCR Length: 1202 bp. Deletion Size: 776 bp. Deletion left flank: AAACCTGAAAATCTTAGTAGCATAAGAACA. Deletion right flank: CTGAAATTCGAAAAAGTTGGTGAGCAAATT. Insertion Sequence: CACA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R10H1.4. Homozygous. Outer Left Sequence: TTGGTCACTGATATGCGCTC. Outer Right Sequence: AAGTCGACCGAGTCGTCAAT. Inner Left Sequence: GGGAAATGAAAATAAGGTCAATG. Inner Right Sequence: TGCTCAACGAGATGTGGAAA. Inner Primer PCR Length: 1194 bp. Deletion Size: 711 bp. Deletion left flank: ATGACCGAGACTGGTCCGACCTCCGATATT. Deletion right flank: GGATTAAATGAAGTTTGGATGGTTTGTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10C2.5. Homozygous. Outer Left Sequence: ACAAACACCAACAGCGATGA. Outer Right Sequence: TCAATTGCAAAAATGCTCGT. Inner Left Sequence: TTGTTGGATTTTGCTTTTACGA. Inner Right Sequence: CTCAGAATTTCCCCCAAAAA. Inner Primer PCR Length: 1134 bp. Deletion Size: 570 bp. Deletion left flank: TTGGCAGAATGTATCGGTATGAGCTATGTA. Deletion right flank: GGTTTATTGCTGAAACTTACTGAGCCGGGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22E10.3. Homozygous. Outer Left Sequence: TCCAGAAGCAGAATTTTGGG. Outer Right Sequence: TGGGTTTTCGAAGGTTTCAC. Inner Left Sequence: GGACCAAAGCTCTGGCAAT. Inner Right Sequence: TTGTTTGCTGTTGTTTCGGA. Inner Primer PCR Length: 1234 bp. Deletion Size: 688 bp. Deletion left flank: GACCAAAGCTCTGGCAATTGCAATTCTCTG. Deletion right flank: AAAGATTGAGTTAGACTGTAATTGATGGCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46A8. Homozygous. Outer Left Sequence: TTTTTACGCGGTAAACCCTG. Outer Right Sequence: AAATTTGGAAGGTTTTGGGG. Inner Left Sequence: TATTCCACACTCAACGCGAG. Inner Right Sequence: ATGGCTGATTATGCTGGGAG. Inner Primer PCR Length: 2229 bp. Deletion Size: 997 bp. Deletion left flank: TGTTTCAATAATACAATAGCTATTTCAGAA. Deletion right flank: AGCGGCAAGATCCACGCCAATGGTCATTCC. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK795.4 Homozygous. Outer Left Sequence: catcaaccaccaccagtgag. Outer Right Sequence: aaaatcgatgcattcggaag. Inner Left Sequence: cggttgggacgatcaaaag. Inner Right Sequence: tcataatacttttccgccgc. Inner Primer PCR Length: 3038. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M88.1. Homozygous. Outer Left Sequence: AAACATGGTTCCCGACATTC. Outer Right Sequence: AATTCGGTGCATTTGGAAAA. Inner Left Sequence: GCAACTTTGGAATTTTTGGG. Inner Right Sequence: ATCAGATTTCCTGCGCAACT. Inner Primer PCR Length: 3024 bp. Deletion Size: 1367 bp. Deletion left flank: ACGCTAAATTGTTTTAATACATTTTAAAGT. Deletion right flank: ATGAAATATTTCTCGATTAAAGTTTCTCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21C9.11. Homozygous. Outer Left Sequence: AAAATTTGAATCGGGCGTTA. Outer Right Sequence: ACTCTTTCGCCTGAAATCCA. Inner Left Sequence: CGATTTTTGTACATTCAGGCAA. Inner Right Sequence: TTTCTGGTCGAAAGTGGTCA. Inner Primer PCR Length: 3024 bp. Deletion Size: 2525 bp. Deletion left flank: AGGCAAAAATCCATTTGTTCCGTCATTTTT. Deletion right flank: GAAATGCCACGTCAGCAGAGTGAAATGTGG. Insertion Sequence: GAACGAAAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08A9.13. Homozygous. Outer Left Sequence: AAGAAAAGCTTGCAACGAGC. Outer Right Sequence: AGCTCCAATTGCAGTTTCGT. Inner Left Sequence: TCAATTGTTCCCCACTCTCC. Inner Right Sequence: CAATGCCACTTCGGTTTCTT. Inner Primer PCR Length: 2631 bp. Deletion Size: 1432 bp. Deletion left flank: AATGTACTAAACATTTATACTATGTTGCAA. Deletion right flank: TTGAGAAGCTTTTTGTGCAGCAATAATGGC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47G4.5. Homozygous. Outer Left Sequence: AAATCGGAAGACAAGCATCG. Outer Right Sequence: AATCCTCTCCAAGTCCCGTT. Inner Left Sequence: TGAATACAAGCCTTCGCCTT. Inner Right Sequence: TTTTCCTTCCAGTGCAATTC. Inner Primer PCR Length: 1117 bp. Deletion Size: 570 bp. Deletion left flank: AAGTGTCCATGCTGATAATATTATCTGAAA. Deletion right flank: ACGGTTGAAGATGACCGCCGCTGTCGGATC. Insertion Sequence: CGGTTGAAGATAATATTATCTGAAACGGTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y76A2B.3 Homozygous. Outer Left Sequence: aacaacacgttgctggagtg. Outer Right Sequence: ccacccatggcctaactcta. Inner Left Sequence: tctaatcgagttggattcacg. Inner Right Sequence: tgcaattacagggtcaacca. Inner Primer PCR Length: 3069. Deletion size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57F4.3. Homozygous. Outer Left Sequence: AGATAGATGGAAGAGCGGCA. Outer Right Sequence: TCGAGATGTACGACGAGTGC. Inner Left Sequence: AGCTTCCTTGACGTTGCAGT. Inner Right Sequence: GGCTGGATATGGTGGAAAGA. Inner Primer PCR Length: 1147 bp. Deletion Size: 658 bp. Deletion left flank: TTTACAACTGGAATAGTGTTTGTGGTGTTTACGGCAGCTTCCTTGACGTTGCAGTTGGT TCCGGTTGTGCAGCAGTAACCGGTGATATCCTTGTCTGTGGAGATGGTCTTACGCTCGT TGTTTAATCCAAGGGACTTGCAAATTGTCTTTGGAACGCAATGATATGACTTGTAAAGA ACATTATTGACAGTTGTCTCAAGAGATCCGCAATATCCGTCACATGATACGGTTCCTCC AACGTTGACATTTCCGTCACTGGTGTAGACTCCGACGTAGCACTTGGCTGGTCC. Deletion right flank: ATTCCAAGTTGATAGCATGTGCTGACTGGATCGCAAGTGTAAATTGTAGCGTTGGTGAG AGCTCCATTGTACATGGTTGAGAGAGTAGCAGAAGCGCATTCTCCCTTACATGCTTGCC AACCAGCGATGGAAATTGGCATGTTATTGACGTAAAGACCAGAGAAGCAAGCGATTGGA TAATCACGGAAGTTCGTAACTGGCATTGAAGTATTGATCTTTCCACCATATCCAGCCAA ATCGACGTTGCAGTTGTTGTAGTTGTCGCAGCAGCATCCCGTAACTGTGGTATCATATG GAAGTGGTTTGCACTCGTCGTACATCTCGAGTTGTCTGCAGAATTGGGTTGGCACGCAT CCGAAGATAGCAACTGGGTCTTGGTTGAGGGTAGCTTGAATTGAGGCGCACTTTCCTGG GCAGAAGATTTCAGATCCAGTGGCCTTTCCTTGAGCGTAGATTCCAGCGAAGCACTTGC GGAATCCAGATGGTACAGTCTTGTTCTTTGGTGGATCAAGGCAGAGATCAGTGTTACAG CAGCATCCGGAGACTCCTGGGATTGGGGAGGCACACCAGTTGTTCATGTTGAGAGATTG GCAAACAGTGCTTGGGTCGCATCCGTAAAGAGTTGCTGTGGTGGCAACTCCGTTGAGTG TAGTGTTCAATGAGATGGACGCACATTGTCCCTGGCAAGCTCCGAGAATGACTGGAGTA GATGGAACACCGTTGACATAAAGTCCAGTGTAGCAAGCAATAGCATAGTCGACTGAAGT TGGTGGTGGTGGTGGAGTGATGGTGGTATTGGCAATGTTACAGTTGTTGGCATTGTTAC AGCAGCATCCAGTGACTTGGTTGTCATTCCAAACTGGTTTGCAGTTGTCGTAGAGTTCA AGGGAGTTACAGATCGAGTTTGGCATGCAGTGATAGGTGTTGACTTGGAATCCACCGAC AACTCCTGAGAGGGATGAGCATTGTCCGTTACATGGAATTTGAGCTCCAACGTTAACTG CGCTTCCATTAACAATGTAGTTCGAGCTGATACCAGCATAGCACATAAGTTGGTTTCCT GGGTTACGAGCTGGATAGACTGTTGGATCAATACAGGCATTGGTGTTACAGCAGCAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21D12.3 Homozygous. Outer Left Sequence: cgctgaaaaacggagaagtt. Outer Right Sequence: taatcaaacgacaccgtcca. Inner Left Sequence: cgaaatttttgaatttttgaatcc. Inner Right Sequence: tggctcaacaactatggtgc. Inner Primer PCR Length: 1362. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47D7A.5. Homozygous. Outer Left Sequence: TTTTTCCCTCTTTATCCCGC. Outer Right Sequence: TGTAAATGTTGTTCCACCGC. Inner Left Sequence: CCAGCCCAACCTAAGCCTAA. Inner Right Sequence: AAACTTTCTGCAAAATGCTCTACA. Inner Primer PCR Length: 1187 bp. Deletion Size: 624 bp. Deletion left flank: ATTAATGTCAATCAGGCTTTCAAGTCAAGG. Deletion right flank: AATCACACTGTTACAAGAGTACAGAAAGAA. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40E10.3. Homozygous. Outer Left Sequence: AGATCCCAGACGATCCAGTG. Outer Right Sequence: CCGAGGCAAAACATCCTAAA. Inner Left Sequence: TGAAAATATGGATGACGAATGTG. Inner Right Sequence: AAGAAACTACCAAGCGGCAA. Inner Primer PCR Length: 1222 bp. Deletion Size: 348 bp. Deletion left flank: AAGTTTATATCCTTGCTAGAAAAAAATAAT. Deletion right flank: AAACACTCCGACTCCAACTTCGAGGCTCTC. Insertion Sequence: TGTGCTCCAGAGAGATCCAAAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22F7.4. Homozygous. Outer Left Sequence: CGTGACGTCAGCACACTTTT. Outer Right Sequence: AATTTTCTTGCCCCCTTCTC. Inner Left Sequence: ACGCGTCGCAATTTTTGTAG. Inner Right Sequence: CGTTTCGCTCGTTTATGTTG. Inner Primer PCR Length: 1283 bp. Deletion Size: 491 bp. Deletion left flank: ATTAATTTTTGTGAACGCCTATTTTAGAGG. Deletion right flank: AAAAAAATTTTTGAAAAAAAAATTTTTTTT. Insertion Sequence: GG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54E2.6. Homozygous. Outer Left Sequence: TGGTGTTCTTCCGACTGTCA. Outer Right Sequence: AATTATTTTGGCGTTCGCTG. Inner Left Sequence: TGCATAGTTTTGCAATTCACC. Inner Right Sequence: GGTTCTGTGCTTTCGATTCC. Inner Primer PCR Length: 1286 bp. Deletion Size: 496 bp. Deletion left flank: AGGTAGGTTCGTTTATCATCGAAAAGCACA. Deletion right flank: TTCAAGCATAATTGTTGATTGAAGATTTAT. Insertion Sequence: ATTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1307.1 Homozygous. Outer Left Sequence: tcacctccttattggttgcc. Outer Right Sequence: atttgccggtgtcttttgag. Inner Left Sequence: tgcaggtgggtagtagaggg. Inner Right Sequence: agatttacaagggttcgggg. Inner Primer PCR Length: 1192. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807