More Fields
Strain Species Genotype
VC10079 C. elegans unc-4(e120) mix-1(gk803) II. Show Description
M106.1. Unc. External left primer: GTTGAGGAAGCAGCTGGAAC. External right primer: TTCTTCGCAGCAGTAATCCC. External WT amplicon: 815 bp. This strain carries a point mutation in M106.1. The mutation is gk803, which is an A->G mutation at R06F6 coordinate 40587 (flanking sequences CACAAAATACCGTAATGACCTCGAATCCCT and ACGAGAGGAACAATTGCTAATGACAAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
SP365 C. elegans unc-4(e120) mix-1(mn29)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc and late larval Unc-4. Maintain by picking WT. mn29 pka let-29(mn29). See also WBPaper00002999.
KK96 C. elegans unc-4(e120) mix-1(b285) sqt-1(sc13)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
mix-1(b285) is maternal effect lethal. Heterozygotes are WT and segregate WT, Unc-4 worms which are strong Egl, and paralyzed Dpy Uncs.