Search Strains

Temperature sensitive. Cell fusion-defective embryos, larvae and adults at 25C. Cell fusion defects are less penetrant at 15C. Egl, Unv, Pvl, Dpy and 2% Muv at 20C and 25C. Mutants have body morphological defects and bulged tails at all temperatures, male tails are leptoderan. Partial sterility of hermaphrodites: brood size is 48 at 25C. sd-4%. ME=0. ES=3. OA-1 (oj55: complete embryonic and partial post-embryonic epithelial fusion failure). Cloned: encodes a type-I membrane glycoprotein with a single TM domain.

jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Temperature sensitive. Cell fusion-defective embryos, larvae and adults at 25C. Cell fusion defects are less penetrant at 15C. Egl, Unv, Pvl, Dpy and 2% Muv at 20C and 25C. Mutants have body morphological defects and bulged tails at all temperature, male tails are leptoderan. Partial sterility of hermaphrodites: brood size is 48 at 25C. ME=0. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Mohler WA, et al. Curr Biol. 1998 Sep 24;8(19):1087-90.

Maintain by picking Lon non-Unc. Throws Lon non-Unc, Lon Unc Vab (bent head, tails very thin), and Lon Unc Mel (kinker, temperature-sterile).

Hermaphrodites have abnormal truncated or blebbed tails, pale appearance, some excretory cell abnormalities, especially in adults. Males have variably abnormal tails, some are able to mate.

muIs27 [mig-2::GFP + dpy-20(+)]. Him. non-Dpy. GFP is membrane enriched and expressed in many cells throughout development (see reference for details). Not known in which LG muIs27 is integrated.

CGC1 (formerly known as PD1074) is intended to be used as a wild-type reference strain with the closely matched genome assembly of Yoshimura, et al. (Genome Res. 2019 Jun;29(6):1009-1022) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). CGC1 is a defined and recently cloned population of animals derived from the original "Bristol" variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenner's original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. CGC1 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. We note that CGC1 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in CGC1. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura, et al, (2019). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

rdIs4 [ehn-3a::Venus(delta)]. Temperature-sensitive. Must be maintained at 15°C to produce progeny. Strain develops as hermaphrodites at 15°C (some animals are intersex with male tails), and develops as XX pseudomales at 25°C. GFP expressed in gonadal precursors. Reference: Kroetz MB & Zarkower D. G3 (Bethesda). 2015 Oct 23;5(12):2831-41.

oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. Wild type worms with mCherry fluorescence in pharyngeal and body wall muscle. Visible on dissection microscope at high magnification. Complex transgene insertion in place of Mos1 allele ttTi5605. Useful for following "invisible" insertions at ttTi5605 site by Mos1 Single Copy gene Insertion (MosSCI). Please note: The insertion was a complex event pulling in more than one transgene and parts of the array. Therefore, the exact molecular structure of the insert is not known. Therefore the strain should NOT be used as a control for insert copy number or other detailed molecular controls of MosSCI insertions. Succesfully used as a balancer for the ttTi5605 locus.

oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi179 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi444 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi177 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi365 [ttTi5605 + NeoR(+) + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals are NeoR and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

oxTi354 [myo-2p::GFP::H2B + ttTi5605 + unc-18(+)]. Unc. Grows best at 20C on HB101. Strain contains a universal MosSCI insertion site that is compatible with targeting vectors for the ttTi5605 site (for example, pCFJ150 derivatives). This site is generally permissive for germline expression. Transgenic animals contain a myo-2p::GFP::H2B construct next to the insertion site and carry an extra copy of unc-18(+). Please see www.wormbuilder.org for more details.

wrdSi58 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140

wrdSi57 [^SEC^eft-3p:TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pick Rollers to maintain. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140

Homozygous viable. km11 is a deletion/duplication of klc-2; see Sakamoto, et al. PMID: 15563606 for detailed description. Reference: Sakamoto R, et al. Mol Biol Cell. 2005 Feb;16(2):483-96. PMID: 15563606

Maternal effect dumpy. Adults are short but larvae are not. Animals are lethargic but display hyperactive foraging movement and very rapid pumping when stimulated by light touch. Hermaphrodite and male tails are abnormal. Very slow development. High degree of embryonic and larval lethality.

Egg laying defective. Retains late stage eggs. Forms bags of worms. Tails variably abnormal. CGC rec'd new stock 8/97.

Heterozygotes are WT and segregate WT, Egls with abnormal tails and DpyUncs.

Severe Unc. Some withered tails. Occasional lateral vulvae. Semi-dominant allele.

Animals with sDp2 are WT. Animals without the duplication are severe Uncs with withered tails, are small and often have lateral ectopic vulvae. gm123 does not survive through more than 1-2 generations. Many cell migrations defects in gm123 animals.

The Null Transcriptional Reporter (NuTR) cassette was used to remove the lep-5 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. Males exhibit typical leptoderan tails.

syIs197 [hs::LIN-3c(cDNA) + myo-2p::DsRed + pha-1(+)]. Him. Maintain at 15C. To induce LIN-3/EGF expression, heat shock at 33C for 30min (water bath) and let animals recover at least 1hr from the behavioral effects of the heat shock. Heat shock-induced LIN-3 should inhibit feeding, locomotion and sensory responses for several hours. For details on EGF-induced quiescence, see Nature Neuroscience 10, 1300 - 1307 (2007). PS5970 is identical to PS5628 as described in Development 137, 2065-2074 (2010) except that it has been outcrossed to remove accumulating suppressors.

oyIs96 [gcy-8p::FlincG3 gcy-8p::myr::TagRFP + unc-122p::dsRed]. Red fluorescence in coelomocytes and faint green fluorescence in AFD head neurons. cGMP fluorescent sensor (FlincG3) expression in AFD neurons allows visualization of AFD signaling. Generated in N2 background. Reference: Extrachromosomal array used in the generation of this strain detailed in https://doi.org/10.1534/genetics.119.302392.

Homozygous sterile deletion as unbalanced heterozygote. Deletion of 5448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Pick viable fertile GFP+ animals to maintain. Heterozygotes are wild-type dim GFP+ and segregate wild-type dim GFP+, bright GFP+ sterile adults (ve696 homozygotes), and non-GFP wild-type homozygotes. Left flanking Sequence: cgcataaaggttttccggcatcgaggtctc ; Right flanking sequence: tggaaaaaatgaatctcgagggattttgag. sgRNA #1: accacgattaccgtatctgg; sgRNA #2: GCTGGGATTGTTGACTGTTc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9

Homozygous sterile deletion as an unbalanced het. Deletion of 3148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ adult sterile animals (ve732 homozygotes) and non-GFP wild-type homozygotes. Maintain by picking wild-type dim GFP+. Left flanking Sequence: GCAGGGACTCGGTGCAGATGCTCCAATCAA ; Right flanking sequence: tgggttatttagcccagttttctatttatt. sgRNA #3: AACTGGAAAACTGGCAATTG; sgRNA #4: AGGCACCACAGAGACTTGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9

Homozygous early larval arrest as an unbalanced heterozygote. Deletion of 852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+ arrested larvae (ve735 homozygotes) and non-GFP wild-type homozygotes. Maintain by picking wild-type dim GFP+. Left flanking Sequence: tttattagcattttttctagaatgtacacg ; Right flanking sequence: tttttttctgtaaattttttacgaaaatat. sgRNA #3: CGTCACCGATAAGCTATCGT; sgRNA #4: ggtaaactacacgcgtggcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9

Homozygous Emb as unbalanced heterozygote. Deletion of 3977 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, dead eggs (ve785 homozygotes) and non-GFP wild-type homozygotes. Maintain by picking wild-type GFP+. Left flanking Sequence: TTCGCATTCCGGAAAGCAAAATTCATTTAC ; Right flanking sequence: TGGTTCCTCCACTTAATGGGAGCAAATCCA. sgRNA #1: AACAAGCTTACGGTCTTCCA; sgRNA #2: CAACATCAGCCGCAATGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9

Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.

Superficially the same as unc-25 mutants (Shrinker, Exp, etc.). Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 and unc-25; snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.

Superficially wild-type. Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.

e1563 homozygotes are superficially wild-type in appearance, development, and behavior. e1563 is a strong, dominant suppressor of UNC-17 G347R mutations (including e245, e359, p300). Molecular details: e1563 corresponds to an I97D (att>>gat) missense mutation in the SNB-1 transmembrane domain. Reference: Sandoval GM, et al. Nat Neurosci. 2006 May;9(5):599-601.

md1447 is a spontaneous 465-bp deletion (with a 2-bp insertion) within the unc-17 3'UTR in a TR638 background. Protein level by immunostaining is barely detectible , but unc-17 behavioral phenotypes are relatively mild. Sequence details (in direction of transcription): TCGTAGATTTGGATCTCTGAATATG/Ä465+AA/AGTGATTTCGTATAGAGTAATGTCA . This allele is the only smg-suppressible allele of unc-17 reported thus far. Since the md1447 deletion is entirely within the unc-17 3'UTR, the amino acid sequence of the UNC-17 protein is completely wild-type. Therefore the phenotype derives from the nonsense-mediated decay of the transcript which in turn leads to an extremely low level of wild-type UNC-17 protein (see figure on following page). Many other unc-17 alleles have reduced immunoreactivity (but more immunoreactivity than md1447) yet significantly stronger behavioral phenotypes than md1447. Therefore, the behavioral phenotypes of these other alleles are not due to reduced transporter. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25.

Small, slow-growing, coily uncoordinated, jerky going backward, aldicarb- and lannate-resistant. Molecular details: G347R (gga>>aga) in the 9th transmembrane domain of the UNC-17 protein. PCR method for scoring the e245 mutation in individual worms is presented in the Supporting Information File of Mathews et al., 2012.

Approximately wild-type for the unc-17 phenotypes; displays typical smg-1 phenotypes (protruding vulvae, defective male tails, poor male mating).

zcIs4 [hsp-4::GFP] V. The identity of upr-1 remains unknown. Animals containing the zc6 mutation can be detected in an hsp-4::GFP background by following the bright green tails under fluorescence microscopy.

Various epidermal defects. In male tails, ray 1 is dislocated anteriorly.

Various epidermal defects. In male tails, ray 1 is dislocated anteriorly.

Variably abnormal. Severe developmental defects. Partially lethal (approx. 2/3 fail to survive). Adult hermaphrodites have variably enlarged and shortened tails and the body cuticle is twisted. Severe egg-laying defect; some animals have a protruding vulva. Tab. Unc. Lack AVM, PVM, and PLM. ALM often fail to migrate or migrate a shorter distance.

jsSi1606 [loxP::unc-116(+)::FRT3] II. Single copy unc-116(+) insertion at the standard Chr II ttTi5605 mosSCI site. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/).

K07C11.2. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok571 hermaphrodites (sterile Uncs with withered tails). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 7 bp. Left flanking sequence: AGCCTTCTGCTGACTAATAACTTTCCATTT; Right flanking sequence: GCGGACTTGCACTGGAAATTTTAATTTCTT. See WormBase Variation gk3858 for details.

Homozygous viable. Deletion of 72 bp with AAAAAAAAAA inserted at break. Left flanking sequence: GGCTATAAGAAGTTGGAGTGCATAAATGAC; Right flanking sequence: TTTTGATCTCAGTTATTACATTAATCAAGG. See WormBase Variation gk3859 for details.

Homozygous viable. Deletion of 536 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTAGTTCTTTAAATGACTACTGTAGTGT; Right flanking sequence: TGGTAACTAATCTCAAATAGATTTTAAATT. See WormBase Variation gk3695 for details.

Homozygous viable. Deletion of 1047 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTATTTGGACAACGCTCTGTGCACAAATCA; Right flanking sequence: TGGCTTAACGAATGAAGATAATGGATTCAA. See WormBase Variation gk3700 for details.

Homozygous viable. Deletion of 886 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTACAGAAGTTTTAAGAAAACTGGGTCAAG; Right flanking sequence: AGGAGCAATTGGCTCAGCAGCATCACCAGC. See WormBase Variation gk3768 for details.

Homozygous viable. Deletion of 857 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGATCAGCCGTACTATTGATACTCTATG; Right flanking sequence: TGGACGATCATGTGATTCGTGTTGACAAAG. See WormBase Variation gk3769 for details.

Homozygous viable. Deletion of 273 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGATGAACGCTTACAGAGAAACGGATATC; Right flanking sequence: AAGAAATATGTGAAACAAGGACGAGTTTGT. See WormBase Variation gk3771 for details.

Homozygous viable. Deletion of 5664 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACCAAACTAAACGCTCTGGACGTGAACATG; Right flanking sequence: GGGGCGCATTTATAGCAAAAACTTCCCAAT. See WormBase Rearrangement gkDf63 for details.