Strain Information

Name RM2710   View On Wormbase
Species C. elegans
Genotypesnf-11(ok156) V.
DescriptionSuperficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
MutagenUV/TMP
Outcrossedx6
Made byOMRF Knockout Group
Laboratory RM
Sign in or register an account if you want to order this strain.