Strain Information
| Name | RM2710 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | snf-11(ok156) V. |
| Description | Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30. |
| Mutagen | UV/TMP |
| Outcrossed | x6 |
| Made by | OMRF Knockout Group |
| Laboratory | RM |
Sign in
or
register an account if you want to order this strain.