Strain Information
| Name | VC3805 View On Wormbase Documentation for VC3805 gkDf63 spp-3 to spp-5 |
|---|---|
| Species | C. elegans |
| Genotype | gkDf63[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] X. |
| Description | Homozygous viable. Deletion of 5664 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACCAAACTAAACGCTCTGGACGTGAACATG; Right flanking sequence: GGGGCGCATTTATAGCAAAAACTTCCCAAT. See WormBase Rearrangement gkDf63 for details. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Vancouver KO Group |
| Laboratory | DM |
| Reference | n/a |
Sign in
or
register an account if you want to order this strain.