Strain Information
| Name | RM580 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | unc-17(md1447) IV. |
| Description | md1447 is a spontaneous 465-bp deletion (with a 2-bp insertion) within the unc-17 3'UTR in a TR638 background. Protein level by immunostaining is barely detectible , but unc-17 behavioral phenotypes are relatively mild. Sequence details (in direction of transcription): TCGTAGATTTGGATCTCTGAATATG/Ä465+AA/AGTGATTTCGTATAGAGTAATGTCA . This allele is the only smg-suppressible allele of unc-17 reported thus far. Since the md1447 deletion is entirely within the unc-17 3'UTR, the amino acid sequence of the UNC-17 protein is completely wild-type. Therefore the phenotype derives from the nonsense-mediated decay of the transcript which in turn leads to an extremely low level of wild-type UNC-17 protein (see figure on following page). Many other unc-17 alleles have reduced immunoreactivity (but more immunoreactivity than md1447) yet significantly stronger behavioral phenotypes than md1447. Therefore, the behavioral phenotypes of these other alleles are not due to reduced transporter. Reference: Mathews EA, et al. Genetics. 2012 Dec;192(4):1315-25. |
| Mutagen | No mutagen |
| Outcrossed | x6 |
| Made by | Minh Nguyen |
| Laboratory | RM |
Sign in
or
register an account if you want to order this strain.