Strain Information
| Name | VC3625 View On Wormbase Documentation for VC3625 gk3859 nhr-286 |
|---|---|
| Species | C. elegans |
| Genotype | nhr-286(gk3859) V. |
| Description | Homozygous viable. Deletion of 72 bp with AAAAAAAAAA inserted at break. Left flanking sequence: GGCTATAAGAAGTTGGAGTGCATAAATGAC; Right flanking sequence: TTTTGATCTCAGTTATTACATTAATCAAGG. See WormBase Variation gk3859 for details. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Greta Raymant |
| Laboratory | DM |
| Reference | n/a |
Sign in
or
register an account if you want to order this strain.