Strain Information
| Name | VC3622 View On Wormbase Documentation for VC3622 gk3858 T26A5.8 |
|---|---|
| Species | C. elegans |
| Genotype | T26A5.8(gk3858) III. |
| Description | Homozygous viable. Deletion of 7 bp. Left flanking sequence: AGCCTTCTGCTGACTAATAACTTTCCATTT; Right flanking sequence: GCGGACTTGCACTGGAAATTTTAATTTCTT. See WormBase Variation gk3858 for details. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Greta Raymant |
| Laboratory | DM |
| Reference | n/a |
Sign in
or
register an account if you want to order this strain.