More Fields
Strain Species Genotype
RM2710 C. elegans snf-11(ok156) V. Show Description
Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
RM2711 C. elegans unc-25(e156) III; snf-11(ok156) V. Show Description
Superficially similar to unc-25 mutants (Shrinker, Exp, etc.), except that unc-25-dependent behaviors are not rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
RM2718 C. elegans snf-3(ok293) II; snf-11(ok156) V. Show Description
Superficially wild-type. Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
RM2717 C. elegans snf-3(ok293) II; unc-25(e156) III; snf-11(ok156) V. Show Description
Superficially the same as unc-25 mutants (Shrinker, Exp, etc.). Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 and unc-25; snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
OH13027 C. elegans otIs569. Show Description
otIs569 [snf-11(fosmid)::SL2::H2B::mChopti + pha-1(+)]. Reporter tag inserted into fosmid WRM064dH02. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13107 C. elegans otIs570 I; him-5(e1490) V. Show Description
otIs570 [snf-11(fosmid)::SL2::H2B::mChopti + pha-1(+)] I. Reporter tag inserted into fosmid WRM064dH02. Him. Line 14-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.