More Fields
Strain Species Genotype
OH14660 C. elegans snf-3(ok293) II; him-5(e1490) V. Show Description
Him. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30.
RM2715 C. elegans snf-3(ok293) II; unc-25(e156) III. Show Description
Superficially similar to unc-25 mutants (Shrinker, Exp, etc.). GABA-dependent phenotypes are rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30. Peden AS, et al. Nat Neurosci. 2013 Dec;16(12):1794-801.
RM2717 C. elegans snf-3(ok293) II; unc-25(e156) III; snf-11(ok156) V. Show Description
Superficially the same as unc-25 mutants (Shrinker, Exp, etc.). Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 and unc-25; snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
RM2718 C. elegans snf-3(ok293) II; snf-11(ok156) V. Show Description
Superficially wild-type. Exogenous GABA does not rescue the unc-25-dependent expulsion deficit. See Mullen GP, et al. [Mol Biol Cell. 2006 Jul;17(7):3021-30.] for detailed description of snf-11 phenotypes. See Peden AS, et al. [Nat Neurosci. 2013 Dec;16(12):1794-801]. for detailed description of snf-3 phenotypes.
RB2165 C. elegans C06E7.1(ok2932) IV. Show Description
C06E7.1 Homozygous. Outer Left Sequence: gttctcgtccgaaacgtcat. Outer Right Sequence: gaaattggggaggaatttgg. Inner Left Sequence: tgcaatgttcttgttgcactc. Inner Right Sequence: ggatatcgaggatattgcgg. Inner Primer PCR Length: 1179. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2166 C. elegans his-70(ok2933) III. Show Description
E03A3.4 Homozygous. Outer Left Sequence: tccgtaaactttaggccacg. Outer Right Sequence: tgttcattgaaatcaccgga. Inner Left Sequence: ccatccactgcagacacagt. Inner Right Sequence: acgtttttgaacgaaatggg. Inner Primer PCR Length: 1316. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2167 C. elegans secs-1(ok2934) V. Show Description
D1054.13 Homozygous. Outer Left Sequence: accttgccagcgtcataatc. Outer Right Sequence: cacgcagtgaaatcttgcat. Inner Left Sequence: aaatgattcgttgatcggga. Inner Right Sequence: tgttgtacccctttgcactg. Inner Primer PCR Length: 1121. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2168 C. elegans ZK1240.2(ok2935) II. Show Description
ZK1240.2 Homozygous. Outer Left Sequence: tgtagtggttttgctctgcg. Outer Right Sequence: cttggcgatacagttggctt. Inner Left Sequence: aattgccagacgacaaatcc. Inner Right Sequence: tggccggaaattagcataaa. Inner Primer PCR Length: 1130. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2169 C. elegans F29G6.3(ok2936) X. Show Description
F29G6.3 Homozygous. Outer Left Sequence: tgtggtgctcatgcttcttc. Outer Right Sequence: tcacacacctacaggtccca. Inner Left Sequence: ctcaaactttctgcgaaggg. Inner Right Sequence: tccgctttgactcatgacag. Inner Primer PCR Length: 1207. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2170 C. elegans F44G3.10(ok2937) V. Show Description
F44G3.10. Homozygous. Outer Left Sequence: TAGCACACAAGGTGGCACTC. Outer Right Sequence: AAAACTCCCAACTCTTCGCA. Inner Left Sequence: CTCACATCCCAGGAAGCATT. Inner Right Sequence: AACGTTTTTGCTGACACACG. Inner Primer PCR Length: 1145 bp. Deletion Size: 664 bp. Deletion left flank: AGTAATAATAAGAATTTAATAAACGAGTAA. Deletion right flank: AACGATTCCAACGCTGCCTCCATCATCCGT. Insertion Sequence: AACGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2171 C. elegans Y4C6A.1(ok2938) IV. Show Description
Y4C6A.1. Homozygous. Outer Left Sequence: GAAAACTCCAAACGGGACAA. Outer Right Sequence: ATTCGGCATACCTTCAAACG. Inner Left Sequence: AAATCAAAAGCCGTTCGTG. Inner Right Sequence: CCCCAACTGAAAATGGCTTA. Inner Primer PCR Length: 1236 bp. Deletion Size: 408 bp. Deletion left flank: CTGTTCAAGTGCAACTTTTCAACTTCTGAA. Deletion right flank: CTGTATTCATCGGTTCGTTTTCTTAAAAAA. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2172 C. elegans ttr-30(ok2939) X. Show Description
T08A9.2. Homozygous. Outer Left Sequence: TAGCGGTGACTCAACGGATT. Outer Right Sequence: AGAAACACGAGTCCCGAGAA. Inner Left Sequence: AAAACGAAGTCACATCATTGAAAA. Inner Right Sequence: CGTGGTTTTTGATAGGAGTACCA. Inner Primer PCR Length: 1116 bp. Deletion Size: 501 bp. Deletion left flank: GAAACATTTGCTATAAAACTTCTCGTCCTC. Deletion right flank: AATCTTCAATCGGTTTCTGTGAACGGAACA. Insertion Sequence: AGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2208 C. elegans C05D9.7(ok2931) X. Show Description
C05D9.7. External left primer: ATGGAATGCAGAAAAATGGC. External right primer: GCCCAAAATTACTGCCAAAA. Internal left primer: CTGGCGGATGATACCAATGT. Internal right primer: AAACCTCGTCGTACGCTTGT. Internal WT amplicon: 1252 bp. Deletion size: 815 bp. Deletion left flank: AATTTCACATTGGAATCAAAATAACTATGC. Deletion right flank: GAAGAAAGAAAAGAAAAAAATTGCAACGAC. Insertion Sequence: GGAGCATATTTTGGACAATGTTATTGAGAATTTTTTTTTGTAAAATTTTTCGAAACAGC CGAAAAAACCAATAACTCGGCTGTCGGCTGACGCCGACAGCCGAAACGAGGCCAATTTC TCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2233 C. elegans Y38H6C.17(ok2930) V. Show Description
Y38H6C.17. External left primer: CCGGTTGCTTACATGCCTAC. External right primer: GATTCGCCAATCTTCCAAAA. Internal left primer: AAGCAATACGTACCGGTCTACA. Internal right primer: AAAGTTTCCAAATTTTTCGGC. Internal WT amplicon: 1372 bp. Deletion size: 549 bp. Deletion left flank: ATTTATGACGTCATCAATACTGGAATATAA. Deletion right flank: ACAATTTTCCAGCAAAAACTTACACTGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807