MT1203 |
C. elegans |
paqr-2(n573) III. Show Description
Egg laying defective. Retains late stage eggs. Forms bags of worms. Tails variably abnormal. CGC rec'd new stock 8/97.
|
|
QC129 |
C. elegans |
paqr-2(tm3410) III. Show Description
Small brood size, reduced adult length, reduced locomotion and reduced life span. Maintain at 25°C. Unable to grow at 15°C. Withered tail-tip phenotype at 20°C and 25°C. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
|
|
QC139 |
C. elegans |
paqr-2(et35) III. Show Description
Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitive; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
|
|
QC140 |
C. elegans |
paqr-2(et36) III. Show Description
Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
|
|
BC10715 |
C. elegans |
dpy-5(e907) I; sIs10236. Show Description
sIs10236 [rCes Y32H12A.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
BC10716 |
C. elegans |
dpy-5(e907) I; sIs10236. Show Description
sIs10236 [rCesY32H12A.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
MT1422 |
C. elegans |
paqr-2(n573) unc-32(e189) III. Show Description
Egl. Unc.
|
|
QC119 |
C. elegans |
ech-7(et6) I; paqr-2(tm3410) III. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. ech-7(et6) suppresses the cold-adaptation defect of paqr-2(tm3410) and partially suppresses the tail tip defect. ech-7(et6); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
|
|
QC120 |
C. elegans |
nhr-49(et7) I; paqr-2(tm3410) III. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et7) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et7); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
|
|
QC121 |
C. elegans |
nhr-49(et8) I; paqr-2(tm3410) III. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et8) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et8); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
|
|
QC122 |
C. elegans |
paqr-2(tm3410) III; pcyt-1(et9) X. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15C and exhibit a withered tail tip phenotype at 20C and 25C. pcyt-1(et9) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); pcyt-1(et9) double mutants can be propagated at 15C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
|
|
QC123 |
C. elegans |
paqr-2(tm3410) III; cept-1(et10) X. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. cept-1(et10) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); cept-1(et10) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
|
|
QC124 |
C. elegans |
paqr-2(tm3410) III; cept-1(et11) X. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. cept-1(et11) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); cept-1(et11) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
|
|
QC125 |
C. elegans |
paqr-2(tm3410) III; hacd-1(et12) V. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. hacd-1(et12) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); hacd-1(et12) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
|
|
QC126 |
C. elegans |
nhr-49(et13) I; paqr-2(tm3410) III. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et13) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et13); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
|
|
QC127 |
C. elegans |
mdt-15(et14) I; paqr-2(tm3410) III. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. mdt-15(et14) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. mdt-15(et14); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
|
|
VC2514 |
C. elegans |
+/mT1 II; Y32H12A.5(ok3136)/mT1 [dpy-10(e128)] III. Show Description
Y32H12A.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3136 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGAGAACGCGAAAACAAGA. External right primer: CAGGACATCGTCCTCCACTT. Internal left primer: GGAACGAAAAGGGGGAATAA. Internal right primer: CGTTCAGTAGCTGCTTCAAGA. Internal WT amplicon: 1358 bp. Deletion size: 299 bp. Deletion left flank: AAAAGCGGCGAGCACGACAAATGTGTGAAA. Deletion right flank: TATACATGGCTCCCATCATAATCATCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
QC142 |
C. elegans |
fld-1(et45) I; paqr-2(tm3410) mdt-15(et14) III. Show Description
No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2.
|
|
QC145 |
C. elegans |
fld-1(et48) I; paqr-2(tm3410) mdt-15(et14) III. Show Description
No obvious phenotype. The fld-1 and mdt-15 mutations act as suppressors of paqr-2.
|
|
QC128 |
C. elegans |
paqr-1(tm3262) IV. Show Description
Superficially wild-type. paqr-1(tm3262) have an increased number of small lipid droplets when combined with paqr-2(tm3410) in double mutants. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
|
|
QC152 |
C. elegans |
mdt-15(et14) III. Show Description
The mdt-15(et14) gain-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. The C5832666T [WS200] mutation can be detected by PCR using the following primers:
mdt-15(et14) Mut Fwd: 5-GTGCCTCCAGATCCACAGCT-3; mdt-15(et14) WT Fwd: 5-GTGCCTCCAGATCCACAGCC-3; mdt-15 Rev: 5-CACCCATTGGAGCACCACT-3. Annealing 65°C, expected product ~400 bp. Reference: Svensk E, et al. PLoS Genetics 9:e1003801. PMID: 24068966
|
|
QC153 |
C. elegans |
fld-1(et46) I. Show Description
The fld-1(et46) loss-of-function mutation has no obvious phenotype on its own but can act as a paqr-2 suppressor. fld-1(et46) carries a mutation in the splice acceptor site of intron 4, i.e. G>A. It can be detected using PCR with annealing at 65°C and using the following primers: et46_WT: atcccccaaaaaacccaatttttttgtag; et46_mut:atcccccaaaaaacccaatttttttgtaa; et46_rev: CCGGAATTGAGACCACctggaac. Expected product size: 389. Reference: Ruiz M, et al. eLife 7:e40686. PMID: 30509349
|
|
QC154 |
C. elegans |
paqr-2(tm3410) III; paqr-1(tm3262) IV. Show Description
This double mutant strain has a severely deformed tail tip and is intolerant of cold (will not grow then die at 15°C) and of dietary saturated fatty acids. Its cell membranes are rigid and rich in saturated fatty acids, and the strain has a small brood size, slow locomotion, permeable cells, autophagy defects as well as other phenotypes. References: Svensson E, et al. PLoS ONE 6(6):e21343. PMID: 21712952. Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
|
|
QC158 |
C. elegans |
paqr-1(et52) IV. Show Description
paqr-1 gain-of-function allele. R109C amino acid substitution isolated in a paqr-2(tm3410) suppressor screen. PCR genotyping can be done with these primers: paqr-1 seq REV: TTTCCGTGTGCAGTGACCA; paqr1_WT_REV: TGCCCTCCCTTTTTACGGCG; paqr1_mut_REV: TGCCCTCCCTTTTTACGGCA. This yields a 441 bp product. Reference: Busayavalasa K, et al. PLoS Genet. 2020 Aug 4;16(8):e1008975. PMID: 32750056
|
|