Search Strains

More Fields
Strain Species Genotype Add
MT4051 C. elegans lin-44(n1792) I; him-5(e1490) V. Show Description
At 20C about 50% of the hermaphrodites are Egl. Males have an abnormal tail and do not mate.
MT6169 C. elegans exc-4(n2400) I. Show Description
Exc canal outgrowth abnormal. PVul. Tail Vab.
MT7626 C. elegans let-7(n2853) X. Show Description
Temperature sensitive - maintain at 15C. Seam cells divide in L4-to-adult molt. Animals undergo extra molt and explode at vulva. Males have leptoderan-like tail. Animals explode or are sterile at 25C.
NA654 C. elegans kal-1(gb503) I. Show Description
Male tail structure defective. kal-1(gb503) is a 2121 bp deletion (14678 to 12577 in cosmid K03D10). Putative null allele.
NC1015 C. elegans unc-119(ed3) III; wdEx457. Show Description
wdEx457 [F39B2.8::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in pharyngeal muscles, posterior ventral cord motor neurons, tail neurons, and a few head neurons. Construct made by M. Vidal lab; candidate unc-37 target gene. F39B2.8 also known as gpr-158.
NC1469 C. elegans unc-119(ed3) III; wdEx575. Show Description
wdEx575 [ZC155.2::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expressed in cholinergic motor neurons, head & tail , neurons, and excretory cell. Construct made by Marc Vidal's group at Harvard as part of the promoterome project.
NC782 C. elegans unc-119(ed3) III; wdEx290. Show Description
wdEx290 [acr-15::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in VNC, head neurons, and tail neurons. Construct made by M. Vidal lab; candidate unc-37 target gene.
NC844 C. elegans unc-119(ed3) III; wdEx345. Show Description
wdEx345 [F55C12.4::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in VNC, head neurons, and tail neurons. Construct made by M. Vidal lab; candidate unc-37 target gene.
NC845 C. elegans unc-119(ed3) III; wdEx346. Show Description
wdEx346 [tig-1::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in head neurons, tail neurons. head muscles, and vulva. Construct made by M. Vidal lab; candidate unc-37 target gene.
NC847 C. elegans unc-119(ed3) III; wdEx348. Show Description
wdEx348 [C13G3.1::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in VNC, head neurons, and tail neurons. Construct made by M. Vidal lab; candidate unc-37 target gene.
NC852 C. elegans unc-119(ed3) III; wdEx353. Show Description
wdEx353 [Y34D9B.1a::GFP + unc-119(+)]. mig-1::GFP construct made by Marc Vidal's group at Harvard as part of the promoterome project; unc-37 target gene. GFP expression observed in all classes of VNC motor neurons, head & tail neurons, body wall muscle, and intestine. [The strain is described as unc-119 and unc-119(+) as the co-injection marker, but looks to actually be lin-15 (Muv).]
NC902 C. elegans unc-119(ed3) III; wdEx381. Show Description
wdEx381 [F55C12.4::GFP + unc-119(+)]. Pick non-Unc to maintain. GFP expression in VNC, head neurons, and tail neurons. Construct made by M. Vidal lab; candidate unc-37 target gene.
NC996 C. elegans wdEx451. Show Description
wdEx451 [Y71D11A.5::GFP + rol-6(su1006))]. Pick rollers to maintain. GFP expression in VD, DD, and AS neurons, multiple head and tail neurons, and muscles.
NG2484 C. elegans vab-8(gm84) V. Show Description
Withered tail. Unc. Small broods. Recessive. Hypomorphic allele of vab-8.
NJ242 C. elegans exc-2(rh90) X. Show Description
Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. 100% penetrant.
NJ469 C. elegans exc-4(rh133) I. Show Description
Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip.
NJ524 C. elegans mua-2(rh174) dpy-18(e499) III. Show Description
Mua, late L4, tail first. Ventral cord abnormal.
NJ555 C. elegans exc-3(rh207) X. Show Description
Excretory canal defect. Canals are shortened and animal is somewhat pale. Defect visible only by Nomarski microscopy. Tail spike is often malformed.
NJ683 C. elegans exc-7(rh252) II. Show Description
Excretory canal defect. Canal is invariably short with multiple cysts of varying size clustered along length, especially at the tips. Visible only by Nomarski microscopy. Tail spike is often slightly malformed. Animal is somewhat pale.
NJ731 C. elegans exc-5(rh232) IV. Show Description
Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the canal tips. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. Impenetrant distal tip cell migration defects (Mig).
NKZ35 C. inopinata Caenorhabditis inopinata wild isolate Show Description
Caenorhabditis inopinata wild isolate; 10x inbred line. Male-Female. Maintain by mating at 25C or above; does not grow well at 20C. See reference for the details d(https://www.nature.com/articles/s41467-018-05712-5). Sibling species of C. elegans. Inbred 10 times, full genome sequence available. Frozen stock recovery is lower efficiency than C. elegans with glycerol; DMSO method works more efficiently. Adult: Large and slender species; ca. 1.5–2.5?mm in length, and individuals may reach up 3.0?mm under optimal culturing conditions. Cuticle is moderate to thick with four-lined lateral field. Deirids on the lateral field, at the level slightly behind the secretory–excretory pore. Lip separated into six sectors, not clearly offset. Six labial sensilla and four cephalic sensilla present. The anterior end of each lip sector very slightly elongated and forming six stomatal flaps. Amphid small, oval pore-like, at the level of the margin of cheilo and gymnostom. Tube-like stoma separated into three parts; short tube-like cheilostom; simple tube-like gymnostom, which is weakly separated into two subsections; and tube-like stegostom covered by pharyngeal sleeve, which is separated into four subsections, prostegostom, mesostegostom, metastegostom, and telostegostom. Metastegostomatal three teeth flap-like. Pharynx separated into four sections; procorpus forming muscular tube, well-developed metacorpus (median bulb); glandular and narrow isthmus; and basal bulb with double haustrulum as the glottoid apparatus. Pharyngo-intestinal valve (cardia) prominent. Nerve ring around the middle of isthmus. Excretory pore located around the margin of isthmus and basal bulb. Female: Gonadal system didelphic, amphidelphic. Anterior and posterior gonadal system are basically symmetric with each other, arranged as ovary, oviduct, spermatheca, spermathecal-uterus junction tissue, uterus and vulva/vagina from distal. Sometimes more than 20 developing eggs are deposited. Tail conical or forming slightly elongated conus with pointed tip. Anus and rectum clearly visible; three (two subventral and one dorsal) rectal glands present. Phasmid forming small pore at ca. 60% of total tail length from anus. Male: Testis single, anteriorly reflexed rightwardly. Vas deferens occupying ca. 1/5 of total gonadal length. Tail enveloped by a closed bursa, supported by nine pairs of bursal rays. Anterior cloacal lip with a rounded and sclerotized appendage and bulge-like appendage between rounded appendage and cloacal opening; a small sensilla-like papilla on the bulge-like appendage. Posterior cloacal lip with tongue-like appendage with two cloacal sensilla. Spicules paired, separate, long and slender with evenly slightly ventrally curved blade and simply pointed tip. Gubernaculum slender, ventrally arcuate with small squared appendage at the distal end in lateral view. Bursa heart-shaped in ventral view, anteriorly closed with serrated edge; serratae obvious in anterior half and vague in posterior half; terminal notch present but unclear. The nine pairs of genital papillae or bursal rays supporting the bursal velum with an arranged (2/1?+?1?+?2?+?3).
NL1604 C. elegans dpy-20(e1282) IV; pkIs584. Show Description
pkIs584 [gpa-7::GFP + dpy-20(+)]. GFP expression in many neurons, muscle cells, and many neurons in the male tail.
OH18353 C. elegans pha-1(e2123) III; otEx8029. Show Description
otEx8029 [ceh-19(prom 2)::GFP + pha-1(+)]. Maintain 25C to select for array. Modified ceh-19 promoter fragment drives bright expression of GFP in MC L/R. There is also expression in an additional unidentified cell in the tail but this expression is much much dimmer and typically not visible under the dissecting scope. GFP expression in MC can be used to isolate MC by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
OH4350 C. elegans otIs151; otEx2504. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2504 [gcy-28(prom1)::GFP + unc-122::GFP]. Expresses GFP in many head neurons, ventral cord and tail neurons, body wall muscle, hypodermis, somatic germline and intestine. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
OH4836 C. elegans otIs7. Show Description
otIs7 [zig-2::GFP + rol-6(su1006)]. Expression variable. Whenever tail non-neuronal cells are on, then PVT is on; apparently more penetrant in adult.
OH7193 C. elegans otIs181 III; him-8(e1489) IV. Show Description
otIs181 [dat-1::mCherry + ttx-3::mCherry]. Him. Expression in DA neurons (ADE, PDE, CEP, male tail) and AIY. Reference: Flames N, Hobert O, 2009 Nature 458, 885-889.
PJ1263 C. elegans gaIs37 IV; unc-51(e369) ccIs55 V. Show Description
gaIs37 [EF1a::Dmek + hs::mpk-1] IV. ccIs55 [unc-54::lacZ + sup-7(st5)] V. Unc. MuV with some frequency at 25C. Low frequency of tail defects at all temps. Appear more Dpy at 25C than 15C.
QC119 C. elegans ech-7(et6) I; paqr-2(tm3410) III. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. ech-7(et6) suppresses the cold-adaptation defect of paqr-2(tm3410) and partially suppresses the tail tip defect. ech-7(et6); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC120 C. elegans nhr-49(et7) I; paqr-2(tm3410) III. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et7) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et7); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC121 C. elegans nhr-49(et8) I; paqr-2(tm3410) III. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et8) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et8); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC122 C. elegans paqr-2(tm3410) III; pcyt-1(et9) X. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15C and exhibit a withered tail tip phenotype at 20C and 25C. pcyt-1(et9) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); pcyt-1(et9) double mutants can be propagated at 15C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC123 C. elegans paqr-2(tm3410) III; cept-1(et10) X. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. cept-1(et10) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); cept-1(et10) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC124 C. elegans paqr-2(tm3410) III; cept-1(et11) X. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. cept-1(et11) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); cept-1(et11) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC125 C. elegans paqr-2(tm3410) III; hacd-1(et12) V. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. hacd-1(et12) suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. paqr-2(tm3410); hacd-1(et12) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC126 C. elegans nhr-49(et13) I; paqr-2(tm3410) III. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. nhr-49(et13) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. nhr-49(et13); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC127 C. elegans mdt-15(et14) I; paqr-2(tm3410) III. Show Description
paqr-2(tm3410) homozygotes are unable to grow at 15°C and exhibit a withered tail tip phenotype at 20°C and 25°C. mdt-15(et14) is a gain-of-function allele and suppresses the cold-adaptation defect and tail-tip defects of paqr-2(tm3410) mutants. mdt-15(et14); paqr-2(tm3410) double mutants can be propagated at 15°C and have a weak tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2013 Sep;9(9):e1003801.
QC129 C. elegans paqr-2(tm3410) III. Show Description
Small brood size, reduced adult length, reduced locomotion and reduced life span. Maintain at 25°C. Unable to grow at 15°C. Withered tail-tip phenotype at 20°C and 25°C. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
QC136 C. elegans iglr-2(et34) III. Show Description
Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitive; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC137 C. elegans iglr-2(et37) III. Show Description
Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC138 C. elegans iglr-2(et38) III. Show Description
Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC139 C. elegans paqr-2(et35) III. Show Description
Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitive; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC140 C. elegans paqr-2(et36) III. Show Description
Maintain at 20-25C. Cold-sensitive; inviable at 15C. Glucose-sensitve; will die on 20 mM glucose when grown on OP50. Characteristic withered tail tip defect. Reference: Svensk E, et al. PLoS Genet. 2016 Apr 15;12(4):e1005982.
QC146 C. elegans fld-1(et49) I; iglr-2(et34) III. Show Description
The fld-1 mutation acts as a suppressor of iglr-2 but the strain still displays weak version of the iglr-2 phenotypes including reduced growth in the presence of glucose or at 15°C, and occasionally produces a tail tip defect.
QC154 C. elegans paqr-2(tm3410) III; paqr-1(tm3262) IV. Show Description
This double mutant strain has a severely deformed tail tip and is intolerant of cold (will not grow then die at 15°C) and of dietary saturated fatty acids. Its cell membranes are rigid and rich in saturated fatty acids, and the strain has a small brood size, slow locomotion, permeable cells, autophagy defects as well as other phenotypes. References: Svensson E, et al. PLoS ONE 6(6):e21343. PMID: 21712952. Devkota R, et al. Genetics (in press). Volume 219, Issue 1, September 2021. https://doi.org/10.1093/genetics/iyab093
QQ251 C. elegans vab-9(ju6) II; mcIs50. Show Description
mcIs50 [lin-26p::vab-10(actin-binding domain)::GFP + myo-2p::GFP + pBluescript]. Variably Abnormal with body shape defects and bobbed tail at all stages. Reference: Vuong-Brender TTK, et al. PLoS One. 2018 Feb 21;13(2):e0193279.
QQ258 C. elegans vab-9(ju6) II. Show Description
Tail whip knobbed at all stages except adult male (adult male tail tip slightly swollen). Reference: Simske JS, et al. Nat Cell Biol. 2003 Jul;5(7):619-25.
RE666 C. elegans ire-1(v33) II. Show Description
Slow growth. Abnormal tail.
RG3440 C. elegans rnp-7(ve940[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III.  Maintain by picking GFP+ Rollers (GFP expression in both pharynx and distal tip cells). Heterozygotes are Rol GFP+ (GFP expression in both pharynx and distal tip cells), and segregate Rol GFP+ (GFP expression in both pharynx and distal tip cells), non-Rol GFP+ (GFP only in pharynx) ve940 homozygotes (Unc, arrest as larvae with a curled tail). qC1[qIs26] is homozygous lethal (unknown stage). Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCTTCGATATCCACCACCGGATCCTCCA; Right flanking sequence: TGGAAGATATTGCACTGGTGGTCGTGCTTC. rnp-7 sgRNA A: GGAAGCCGATACAGTACAGG; rnp-7 sgRNA B: ACTAGTAGGTCCTGGCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RSL10 C. elegans unc-94(ftw3[GFP::unc-94]) I; myo-3(ftw6[myo-3(head)::SL2::mCherry::myo-3(tail)]) V. Show Description
GFP tag inserted in endogenous unc-94 locus; specifically tags UNC-94A isoform. Green fluorescence is visible by compound microscopy as striations in body wall muscles, as elongated puncta in single-sarcomere (anal depressor, uterine, and vulval) muscles, as well as the cell bodies of two neurons. Not visible on fluorescent dissection microscopes. Modifcation of the endogenous myo-3 loci by the insertion of a trans-splicing ICR region and worm-optimized mCherry at region encoding the head-neck junction. Bright red fluorescence is visible as striations in body wall muscles and clusters in single-sarcomere (anal depressor, vuvla, uterine) muscles. Please contact Ryan Littlefield prior to publishing work using this strain.
RSL6 C. elegans myo-3(ftw6[myo-3(head)::SL2::mCherry::myo-3(tail)]) V. Show Description
Modifcation of the endogenous myo-3 loci by the insertion of a trans-splicing ICR region and worm-optimized mCherry at region encoding the head-neck junction. Bright red fluorescence is visible as striations in body wall muscles and clusters in single-sarcomere (anal depressor, vuvla, uterine) muscles. Worms are phenotypically wildtype. Please contact Ryan Littlefield prior to publishing work using this strain.