Search Strains

More Fields
Strain Species Genotype Add
CB7272 C. elegans ccIs4251 I; mIs12 II; dpy-17(e164) III; frIs7 IV; uIs69 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. uIs69 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1] V. Mapping strain. This strain is homozygous for integrated fluorescence markers on LG I, II, IV and V, all of which are easily and independently scored using a fluorescent dissecting microscope, plus an easily scored visible marker (dpy-17) for LGIII. The good markers on all five autosomes facilitate linkage assignment of unmapped mutations, and enable rapid replacement of chromosomes when outcrossing heavily mutagenized strains such as those from the Million Mutation Project.
CB7587 C. elegans ptr-15(gk5234) V; crEx498. Show Description
crEx498 [dpy-14p::ptr-15(+) + sur-5p::GFP]. Pick animals with nuclear GFP throughout body to maintain. Lethal ptr-15 deletion allele marked with pharyngeal GFP [loxP ::myo-2p::GFP::unc-54 3’UTR + rps-27p::neoR::unc-54 3’UTR::loxP]; lethality rescued by hypodermal expression of PTR-15 form crEx498 array. Non-nuclear GFP animals (only pharyngeal expression) will be dead eggs and dead hatchlings. Derived from parental strain VC4151. References: O’Rourke et al. (in revision 2024).
CF1135 C. elegans egl-20(n585) IV; muEx68. Show Description
muEx68 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
CF1170 C. elegans egl-20(n585) IV; muEx79. Show Description
muEx79 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
CGC104 C. elegans mir-61(umn16[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC102, leaving disrupted mir-61 locus.
CGC105 C. elegans hIn1 [umnIs78] I. Show Description
umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::mKate2 transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.
CGC112 C. elegans mir-250(umn23[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC110, leaving disrupted mir-250 locus.
CGC115 C. elegans mir-61&mir-250(umn26[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC113, leaving disrupted mir-61&mir-250 loci.
CGC122 C. elegans mir-392(umn33[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-392 pre-miRNA deletion strain deletion allele in which mir-392 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC123 C. elegans mir-57(umn34[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) II. Show Description
mir-57 pre-miRNA deletion strain deletion allele in which mir-57 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC128 C. elegans +/hT2 [umnIs15] I; dcr-1(pk1351)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, dcr-1 homozygotes (protruding vulva, sterile/egl, rupture at vulva), lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Pvul. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived from parental strains CGC26 and NL687. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC135 C. elegans let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
CGC138 C. elegans unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs79] V. Show Description
umnIs79 [myo-2p::GFP + NeoR, I: 6284001] I. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, arrested hT1 homozygotes (GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
CGC139 C. elegans unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs80] V. Show Description
umnIs80 [myo-2p::mKate2 + NeoR, I: 6284001] I. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
CGC140 C. elegans goa-1(n499)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
This strain is difficult and time consuming to maintain. Gives relatively few heterozygotes. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are paralyzed Unc and Egl with relatively dim pharyngeal GFP (Venus) expression. Heterozygotes segregate heterozygous non-Dpy GFP+ paralyzed Unc and Egl, non-GFP embryonic lethal (homozygous n499), and Dpy with brighter GFP+ (tmC20 homozygous). Remove Dpy from plate to prevent them from taking over. Heterozygotes tend to stack up in parallel clumps. Populations can be enriched by transferring these clumps to new plates and allowing Dpy (tmC20 homozygotes) to crawl out into bacterial lawn, and then picking away Dpy or transferring the clump of Hets to another plate. Derived by balancing n499 from parental strain MT1102 over tmC20 from FX30179.
CGC146 C. elegans mir-800(umn53[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-800 pre-miRNA deletion allele in which mir-800 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC147 C. elegans mir-1818(umn54[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])I. Show Description
mir-1818 pre-miRNA deletion allele in which mir-1818 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC148 C. elegans mir-47(umn55[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])I. Show Description
mir-47 pre-miRNA deletion allele in which mir-47 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC149 C. elegans mir-81(umn56[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])I. Show Description
mir-81 pre-miRNA deletion allele in which mir-81 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC150 C. elegans mir-1829.3&F39B1.3(umn57[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])X. Show Description
mir-1829.3 pre-miRNA & F39B1.3 deletion allele in which mir-1829.3 pre-miRNA & F39B1.3 was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC151 C. elegans mir-1829.2(umn58[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-1829.2 pre-miRNA deletion allele in which mir-1829.2 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC154 C. elegans mir-4812(umn61[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-4812 pre-miRNA deletion allele in which mir-1824 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC177 C. elegans lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
CGC18 C. elegans umnIs7 III. Show Description
umnIs7 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC19 C. elegans eT1 III; eT1 [umnIs8] V. Show Description
umnIs8 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
CGC20 C. elegans dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs9] V. Show Description
umnIs9 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC22 C. elegans umnIs11 V. Show Description
umnIs11 [myo-2p::GFP + NeoR, V:1005689 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC23 C. elegans dpy-18(e364)/eT1 [umnIs12] III; unc-46(e177)/eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC24 C. elegans umnIs13 X. Show Description
umnIs13 [myo-2p::GFP + NeoR, X: 6745526 (intergenic)] X. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC25 C. elegans hT2 [umnIs14] I; hT2 [bli-4(e937)] III. Show Description
umnIs14 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] I. Homozygous viable. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR1234 using CRISPR/Cas9.
CGC26 C. elegans dpy-5(e61)/hT2 [umnIs15] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CGC27 C. elegans umnIs16 X. Show Description
umnIs16 [myo-2p::GFP + NeoR, X:15420938 (intergenic)] X. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC28 C. elegans +/szT1 [lon-2(e678) umnIs17] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs17 [myo-2p::GFP + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC29 C. elegans unc-13(e51)/hT1 [umnIs18] I; dpy-11(e224)/hT1 [unc-42(e270)] V. Show Description
umnIs18 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Dpy Unc, arrested hT1 homozygotes(GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
CGC30 C. elegans unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs19] (IV;V;f). Show Description
umnIs19 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type GFP+; animals that have lost the Dup are Dpy Unc GFP-. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.
CGC31 C. elegans umnIs20 III. Show Description
umnIs20 [myo-2p::GFP + NeoR, III:518034 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC32 C. elegans sC1(s2023) [dpy-1(s2170) umnIs21] III. Show Description
umnIs21 [myo-2p::GFP + NeoR, III: 518034 (intergenic)]. Dpy GFP+. Derived by insertion of myo-2p::GFP transgene into sC1 balancer in parental strain BC4279 using CRISPR/Cas9.
CGC33 C. elegans unc-5(e53)/nT1 [umnIs22] IV; dpy-11(e224)/nT1 V. Show Description
umnIs22 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC34 C. elegans eT1 [umnIs12] III; eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC35 C. elegans +/szT1 [lon-2(e678) umnIs24] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, dead eggs and GFP+ Lon males. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC36 C. elegans mnDp1 [umnIs25] (X;V)/+ V; unc-3(e151) X. Show Description
umnIs25 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)]. Pick wild-type GFP+ to maintain. Segregates lethals: homozygous Dp/Dp are lethal. Derived by insertion of myo-2p::GFP transgene into mnDp1 duplication in parental strain SP219 using CRISPR/Cas9.
CGC37 C. elegans unc-3(e151) X; mnDp3 [umnIs26] (X;f). Show Description
umnIs26 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)]. Pick wild-type GFP+ to maintain. Segregates wild-type GFP+ and Unc GFP-. Derived by insertion of myo-2p::GFP transgene into mnDp3 duplication in parental strain SP123 using CRISPR/Cas9.
CGC38 C. elegans umnIs27 III. Show Description
umnIs27 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9.
CGC39 C. elegans unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs28] V. Show Description
umnIs28 [myo-2p::GFP + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
CGC40 C. elegans +/szT1 [lon-2(e678) umnIs29] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs29 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-GFP, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9.
CGC41 C. elegans +/szT1 [lon-2(e678) umnIs30 umnIs24] I; dpy-8(e1321) unc-3(e151)/szT1 X. Show Description
umnIs30 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Carries szT1 balancer with mKate2 tag on left arm and GFP tag on right arm. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by insertion of myo-2p::mKate transgene into szT1 balancer in parental strain CGC35 using CRISPR/Cas9.
CGC42 C. elegans mnDp10 [umnIs31] (X;I); unc-3(e151) X. Show Description
umnIs31 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Segregates mostly wild-type GFP+ and occasional Unc GFP-. Maintain by picking WT GFP+. Derived by insertion of myo-2p::GFP transgene into mnDp10 duplication in parental strain SP117 using CRISPR/Cas9.
CGC43 C. elegans unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444) umnIs32] II. Show Description
umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Hets are WT GFP+ and segregate WT GFP+, Unc-4 (GFP-) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Derived by insertion of myo-2p::GFP transgene into mnC1 balancer in parental strain SP127 using CRISPR/Cas9.
CGC44 C. elegans unc-4(e120)/mIn1 [dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-4 non-GFP, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mIn1 balancer in parental strain DR1785 using CRISPR/Cas9.
CGC45 C. elegans unc-4(e120)/mT1 [umnIs34] II; mT1 [dpy-10(e128)]/dpy-17(e164) III. Show Description
umnIs34 [myo-2p::GFP + NeoR, III: 8856215 (intergenic)] II. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc non-GFP, sterile Dpy GFP+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into mT1 balancer in parental strain DR1832 using CRISPR/Cas9.