More Fields
Strain Species Genotype
CGC150 C. elegans mir-1829.3&F39B1.3(umn57[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272])X. Show Description
mir-1829.3 pre-miRNA & F39B1.3 deletion allele in which mir-1829.3 pre-miRNA & F39B1.3 was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CX3572 C. elegans kyIs105 V; lin-15B&lin-15A(n765) X. Show Description
kyIs105 [str-3p::snb-1::GFP + lin-15(+)]. Also known as str-3::VAMP::GFP or ASI::VAMP::GFP or M7::VAMP::GFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX652 C. elegans kyIs235 V; syg-1(ky652) X. Show Description
kyIs235 [unc-86::snb-1::YFP + unc-4p::lin-10::RFP(intron) + odr-1::RFP]. Also known as unc-86::VAMP::YFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX6632 C. elegans kyEx728. Show Description
kyEx728 [sra-6p::G-CaMP]. No co-injection marker -- pick GFP+ animals to maintain.
DA1917 Escherichia coli E. coli. Show Description
Bacteria. Contains eat-5 rescuing plasmid pRE5-7. Amp-R. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. Biosafety Level: BSL-1.
DA2124 Escherichia coli E. coli. Show Description
Bacteria. E. coli strain carrying an avr-15::GFP fusion plasmid. Amp-R. Sac I Pst I fragment from K10B8 fused to transmembrane GFP from TM-1. Biosafety Level: BSL-1.
GC363 Escherichia coli E. coli. Show Description
Bacteria. E. coli HT115(DE3) bacterial strain carrying pGC8. pGC8 is a partial cDNA of him-14 (ZK1127.11) cloned into the Timmons and Fire "double T-7 vector" L4440. The source of the cDNA is Yuji Kohara's clone yk240h12. pGC8 was constructed by inserting the 1.65kb KpnI/SacI fragment of the him-14 cDNA (from base pair 1071 to 192 base pairs beyond the stop codon) into the same sites in L4440. HT115(DE3) carrying pGC8 should be selected in the presence of 50 um/ml tetracyline and 100 um/ml ampicillin. Prior to an actual feeding experiment, it can be grown in liquid in the presence of amp alone (no tet) and then seeded onto NGM plates containing amp and 1 mM IPTG. This technique does not work well if the cells are old; therefore, the strain should be seeded onto IPTG-containing plates from a fresh overnight that was grown from a colony on an amp/tet plate. Biosafety Level: BSL-1. For more info see http://www.wormbook.org/wli/wbg17.1p32/
HBR2256 C. elegans goeEx737. Show Description
goeEx737 [flp-24p::SL1::GCaMP3.35-SL2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. ALA-specific expression of GCaMP with an additional mKate marker for expression reference. Pick mKate+ to maintain. High transmission rate (>99%). Reference: Konietzka et al. 2019. Current Biology (accepted).
JK4930 C. elegans lag-1(q426) IV/nT1[qIs51](IV; V). Show Description
Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP q426 homozygotes (variable phenotypes including sterile, L1 lethal, and small sterile adults with rectal protrusion and occasional bent pharynx). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kadyk LC & Kimble J. Development. 1998 May;125(10):1803-13. doi: 10.1242/dev.125.10.1803. PMID: 9550713.
KG532 C. elegans kin-2(ce179) X. Show Description
Adults generally short, although some can reach near normal length. Slow growth rate. Backing can be loopy, but does not like to back. Strongly hypersensitive to stimuli. Relatively constant spontaneous movement. Some clustering especially in response to stimuli. Mature adults have vulval bump. Most young adults are Egl-c and young embryos can be found on the plate. Some mature adults become moderately Egl-d. Recessive allele. Males are small and slow growing. Mutation is R92C, which is a conserved residue in the 10 amino acid inhibitory domain that normally functions to keep protein kinase A turned off in the absence of cAMP. Population tends to severely crash within 2-3 weeks of starvation.
KRA582 C. elegans pha-1(e2123) III; kasEx271. Show Description
kasEx271 [pxd-1::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with pxd-1 genomic region (-2,165 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
KRA584 C. elegans pha-1(e2123) III; kasEx273. Show Description
kasEx273 [cal-2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with cal-2 genomic region (-3,326 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
KRA586 C. elegans pha-1(e2123) III; kasEx275. Show Description
kasEx275 [lgc-4::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with lgc-4 genomic region (-669 to +1,797 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
KRA588 C. elegans pha-1(e2123) III; kasEx277. Show Description
kasEx277 [ldb-1::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with ldb-1 genomic region (+1,063 to +4,393 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
KRA590 C. elegans pha-1(e2123) III; kasEx279. Show Description
kasEx279 [nep-21::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with nep-21 genomic region (-3,471 to -865 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
KRA592 C. elegans pha-1(e2123) III; kasEx281. Show Description
kasEx281 [D2007.2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with D2007.2 genomic region (-2,997 to -517 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
KRA594 C. elegans pha-1(e2123) III; kasEx283. Show Description
kasEx283 [dmsr-2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with dmsr-2 genomic region (-3,452 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
KRA595 C. elegans pha-1(e2123) III; kasEx284. Show Description
kasEx284 [ncs-2::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with ncs-2 genomic region (-3,455 to -1 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
KRA597 C. elegans pha-1(e2123) III; kasEx286. Show Description
kasEx286 [npr-29::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with npr-29 genomic region (-9,810 to -6,028 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
KRA599 C. elegans pha-1(e2123) III; kasEx288. Show Description
kasEx288 [drn-1::RFP + pha-1(+)]. Maintain at 25C to select for array. RFP fused with drn-1 genomic region (-6,346 to -4,825 bp). Reference: Li Y & Kratsios P. Micropubl Biol. 2021 Sep 14;2021:10.17912/micropub.biology.000453. PMID: 34549172.
MT23162 C elegans kyIs511 V; nEx2316. Show Description
kyIs511 [gcy-36p::GCaMP + unc-122p::GFP]. nEx2316 [gcy-36p::gur-3 + ges-1p::GFP]. Pick animals with GFP expression in gut to maintain. Expression of gcy-36p::gur-3 causes URX to respond to light 30% of the time. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18. doi: 10.1016/j.neuron.2014.12.061. PMID: 25640076.
MT23338 C. elegans nIs686 III; lin-15B&lin-15A(n765) X. Show Description
nIs686 [gpa-16p::GCaMP3::unc-54 3' UTR + lin-15(+)] III. Expression of GCaMP in RIP, pharyngeal muscle (pm2, pm3, and dimly/occasionally in pm1), mc1 marginal cells, and other unidentified cells. Derived by gamma-irradiation of nEx2309 in parental strain MT23222 and out-crossed five times to MT8189 lin-15B&lin-15A(n765). Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341
NM5953 C. elegans jsSi1949 II; him-8(e1489) IV. Show Description
jsSi1949 [loxP + myo-2p::FRT::nls::mNG myo-2 3' + <{rps-0p HygR unc-54 3'} ori <{Amp} <{mex-5p nls-Cre tbb-2 3'} + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM5970 C. elegans jsSi1973 I; him-8(e1489) IV. Show Description
jsSi1973 [mosL + loxP + myo-2p::FRT::nls::mNG::myo-2 3' + <{rps-0p::HygR::unc-54 3'} + ori <{Amp} <{mex-5p::nls::Cre::tbb-2 3'} + FRT3 + mosR] I. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM6037 C. elegans jsSi2049 V. Show Description
jsSi2049 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} mex-5p::nls::Cre::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
NM6168 C. elegans jsSi2027 II; him-8(e1489) IV. Show Description
jsSi2027 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} + mex-5p::nls::Cre::glh-2 3' + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
OD3696 C. elegans plk-1(lt106[plk-1 C52V] lt108[plk-1 L115G]) III. Show Description
Analog-sensitive allele generated by CRISPR/Cas9 engineering of the endogenous plk-1 locus. Engineered mutations confer sensitivity to 1-NM-PP1 for drug inhibition of plk-1. gRNA sequences: GGACGATTTTTGGGCAAGGG & TCTCAACGTGTATATCACTT Reference: Gomez-Cavazos JS, et al. Curr Biol. 2020 Aug 17;30(16):3101-3115.e11. doi: 10.1016/j.cub.2020.05.090 PMID: 32619481.
OD3737 C. elegans cyb-3(lt110) V/nT1 [qIs51] (IV;V). Show Description
CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OH15034 C. elegans otIs653. Show Description
otIs653 [srg-8p::mCherry + cho-1p::mCherry + srg-8p::nlg-1::spGFP1-10 + cho-1p::nlg-1::spGFP11]. GRASP labeling of ASK to AIA synapses. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH15338 C. elegans ceh-32(ok343) V; otEx7146. Show Description
otEx7146 [ceh-32(+) fosmid WRM0637dA10 + myo-2p::RFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH16085 C. elegans otIs748 X. Show Description
otIs748 [rab-3p(prom1)::GFP + ttx-3p::mCherry] X. Pan-neuronal cytoplasmic GFP expression. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH16737 C. elegans otIs788. Show Description
otIs788 [cat-4p::GFP::cla-1 + cat-4p::mCherry + inx-16p::tagRFP]. GFP-tagged CLA-1 provides a synaptic marker in HSN neurons. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH16765 C. elegans otIs794. Show Description
otIs794 [cho-1(fosmid)::NLS::SL2::YFP::H2B + eat-4(fosmid)::SL2::LSSmOrange::H2B + unc-47p::tagBFP2 + cat-1p::mMaroon + rab-3p1::2xNLS::tagRFP]. cho-1 fosmid reporter construct labels cholinergic neurons. eat-4 fosmid reporter construct labels glutamatergic neurons. unc-47p::tagBFP2 reporter (contains -2778 to -1 promoter region) labels GABAergic neurons. cat-1p::mMaroon reporter (contains -1599 to -1) labels monoaminergic neurons. rab-3p::tagRFP (contains -1462 to +2921 of prom1) labels all neurons (pan-neuronal marker). Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OH16971 C. elegans otIs816. Show Description
otIs816 [klp-6p::mCherry + klp-6p::GFP::cla-1]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH17072 C. elegans otIs833. Show Description
otIs833 [egas-4p::TagRFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH17217 C. elegans otIs846. Show Description
otIs846 [egas-1p::GFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH17368 C. elegans otIs854. Show Description
otIs854 [unc-39p::tagRFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH17502 C. elegans otIs867. Show Description
otIs867 [srh-71p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OP50-tdTomato Escherichia coli E. coli Show Description
Bacteria. A22 tdTomato-expressing OP50. Amp Resistant. tdTomato coding sequence was cloned into pGEX-5x-3 vector and transformed into OP50 component cells. Reference: Zhang B, et al. Nat Aging 2021 1, 255–268. https://doi.org/10.1038/s43587-021-00039-1.
PHX4447 C. elegans aex-2(syb4447 [aex-2::SL2::GFP::H2B)] X. Show Description
CRISPR/Cas9 engineered tagged endogneous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
PR671 C. elegans tax-2(p671) I. Show Description
Defective in chemotaxis to Na+, Cl-, OH-, NaHCO3, pyridine, cAMP, D-tryptophan, CO2(phosphate). Partially defective in chemotaxis to H+(phosphate). Slightly inverted taxis to H+(citrate). Thermotaxis defective too.
PR672 C. elegans che-1(p672) I. Show Description
Defective in chemotaxis to Na+, OH-, NaHCO3; partially defective in chemotaxis to CL-; inverted taxis to cAMP.
PR675 C. elegans tax-6(p675) IV. Show Description
Defective in chemotaxis to Na+, Cl-, OH-, NaHCO3, pyridine, cAMP, D-tryptophan; partially defective to CO2(phosphate), H+(phosphate), H+(citrate); a little Small. Thermotaxis is funny.
PR678 C. elegans tax-4(p678) III. Show Description
Defective in chemotaxis to Na+, NaHCO3, pyridine, cAMP, D-tryptophan; partially defective to CO2(phosphate)m H+(phosphate),, H+(citrate); inverted taxis to Cl-, OH-. Progeny yield about 50% of normal. No Thermotaxis. See also WBPaper00002585.
PW20 Escherichia coli E. coli. Show Description
Bacteria. E. coli harboring the plasmid PB255, which uses the lin-31 promoter variant to express the lin-31::VP16 chimeric gene. It is particularly useful for the expression of heterologous genes in the vulval precursor cells. PB255 possesses three main components : an enhancer, a promoter region, a multi-cloning site (MCS), and a 3' UTR derived from the unc-54 gene. [CGC note: The plasmid in this strain was constructed from pBS II KS(+) and is likely Amp-R, but Amp-R has not been confirmed]. Biosafety Level: BSL-1.
PX176 C. elegans Show Description
Isolated at 2151 Bunker Ridge Road, Eugene, OR. From damp grass compost in a field.
PX178 C. elegans Show Description
Isolated in northwest Hendricks Park, Eugene, OR. From under rocks over damp, organic soil. Isolated from a snail.
PX179 C. elegans Show Description
Isolated in northwest Hendricks Park, northwest rhododendron garden, Eugene, OR. From under rocks over damp, organic soil. Isolated from a snail.
RB902 C. elegans jamp-1(ok765) V. Show Description
R01B10.5 Homozygous. Outer Left Sequence: CGTTATTAAAAGGCACCCGA. Outer Right Sequence: CCATGTCATCATTGTCTGGC. Inner Left Sequence: TCTTTGGAAATTCGGGTGAC. Inner Right Sequence: GCCATCATGTCTCGGATTCT. Inner Primer PCR Length: 2994. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
SRS85 C. elegans sraIs49 V; lite-1(ce314) X; sraEx80. Show Description
sraIs49 contains [nmr-1p::G-CaMP + unc-119(+)]. sraEx80 contains [sra-6p::chop-2(H134R)::mCherry + osm-10p::G-CaMP + unc-122p::mCherry]. Superficially wild-type. Maintain by picking red fluorescent worms.