| DV3208 |
C. elegans |
daf-15(re147[daf-15::mNG::2xHA]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.
|
|
| DV3285 |
C. elegans |
his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background.
C-terminally tagged mpk-1 is detectable by triplex PCR:
mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG
mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC
mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC
Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
|
|
| DV3313 |
C. elegans |
rap-1(re180) IV. Show Description
Gain-of-function allele (G12V). Low penetrance of 3? to 1? fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933.
|
|
| DV3327 |
C. elegans |
pmk-1(re170[pmk-1::mNG::3xFlag]) IV. Show Description
mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
| DV3525 |
C. elegans |
daf-15(re257[daf-15::mNG::AID*]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus; AID* at 3' end of mNeonGreen. Ubiquitous expression. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin.
|
|
| DV3670 |
C. elegans |
rheb-1(re64 re285[AID*::mKate2::3xFlag::rheb-1]) III. Show Description
AID* tag in 5' end of mKate2-tagged endogenous rheb-1. Ubiquitous mKate2 expression. rheb-1 crRNA#1: cgugugaaaauaagagacgg / crRNA #2: gcacatagcagcgtttcaca / insertion site: ttttgtgaagATG^AGCAGTT. universal mKate2 site crRNA: catgttttctttaatgagct / insertion site in mKate2:gaagATGCCA....GGAGCATCGGGAGCCTCAGGAGCATCGATGGTCTCCGAGC^TCATTAAAGA. Reference: Fakieh R, et al. MicroPubl Biol. 2022 Aug 9:2022:10.17912/micropub.biology.000622. doi: 10.17912/micropub.biology.000622. PMID: 36035777.
|
|
| DV3765 |
C. elegans |
scd-1(re305[scd-1::mKate2::2xHA]) X. Show Description
mKate GLO (germline optimized) tag inserted at C-terminus of endogenous SCD-1. Red fluorescence in all nuclei. Cas9 guide + PAM: GACTTGGAAGAAGACGGTGG+AGG. Reference: Ailion M, et al. In preparation.
|
|
| DV3799 |
C. elegans |
reSi1 I. Show Description
reSi1 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei.
|
|
| DV3800 |
C. elegans |
reSi2 II. Show Description
reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in hypodermal nuclei.
|
|
| DV3801 |
C. elegans |
reSi3 I. Show Description
reSi3 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
|
|
| DV3803 |
C. elegans |
reSi5 I. Show Description
reSi5 [ges-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Intestinal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in intestinal nuclei.
|
|
| DV3805 |
C. elegans |
reSi7 I. Show Description
reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in neuronal nuclei. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).
|
|
| DV3825 |
C. elegans |
reSi11 II. Show Description
reSi11 [unc-54p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Muscle-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in muscle nuclei.
|
|
| DV3826 |
C. elegans |
reSi12 II. Show Description
reSi12 [ges-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Intestinal-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in intestinal nuclei.
|
|
| DV4326 |
C. elegans |
bar-1(ga80) X. Show Description
Variably penetrant Unc, Vul, pVul, Egl, vulval rupture, and slow growth. Parental strain EW15 was outcrossed to separate bar-1(ga80) from a described background PRY-1(N354K) mutation. The phenotypes of the outcrossed strain are much more severe than those of the progenitor strain EW15.
|
|
| DW101 |
C. elegans |
atl-1(tm853) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Heterozygotes are Unc and GFP+ with signal in the pharynx. atl-1(tm853) homozygotes are non-Unc, viable, GFP-, and produce 100% dead embryos. qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine. nT1[unc-?(n754) let-? qIs50] is also known as DnT1[qIs50]. qIs50 is apparently inserted on DnT1. qIs50 is somewhat dimmer than the similar qIs51.
|
|
| DW104 |
C. elegans |
brc-2(tm1086) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
tm1086 is homozygous lethal. Maternally rescued. Fails to produce viable progeny due to a defect in repairing meiotic DNA double-strand breaks. Chromosomes are visibly aggregated at diakinesis. Maintain by picking GFP progeny and checking that the non-GFP progeny that are produced fail to give viable progeny. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
|
|
| DWF1107 |
Acrobeloides butschlii |
Show Description
Original sample from peach orchard at Lodi CA. Original culture sent to DWF from B. Jaffee. Identification by E. Mae Noffsinger.
|
|
| DWF1108 |
Acrobeloides sp. |
Show Description
Originally from ecological study at University of GA. Identification by E. Mae Noffsinger.
|
|
| DWF1109 |
Acrobeloides thornei |
Show Description
Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. [6/98: Paul De Ley has checked this strain and suggests that it doesn't match the original description of Acrobeloides thornei very well.]
|
|
| DWF1110 |
Acrobeloides ellesmerensis |
Show Description
Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. Isolated in CA.
|
|
| DWP219 |
C. elegans |
daam-1(ups39) V. Show Description
Superficially wild-type. ups39 is a CRISPR-engineered deletion within daam-1. daam-1(ups39) encodes an in-frame stop codon near the start of its FH2-coding sequence, and a 1-nt frame shift due to the LoxP site, and is thus predicted encode a non-functional formin. Reference: Sundaramurthy S, et al. Cytoskeleton (Hoboken). 2020 Oct;77(10):422-441. doi: 10.1002/cm.21639. PMID: 33103378.
|
|
| DZ205 |
C. elegans |
dsh-2(ez25)/mIn1 [mIs14 dpy-10(e128)] II; him-8(e1489) IV. Show Description
mIs14 [myo-2p::GFP + pes-10p::GFP]. Him. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and Egl non-GFP ez25 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| DZ240 |
C. elegans |
fkh-6(ez16)/mIn1 [dpy-10(e128) mIs14] II; him-8(e1489) IV. Show Description
Heterozygotes are WT and GFP+ in the pharynx. mIn1[dpy-10(e128) mIs14] homozygotes are Dpy and GFP+ in the pharynx. Homozygous fkh-6(ez16) hermaphrodites are sterile and have gonadogenesis defects. Homozygous fkh-6(ez16) males are sterile and strong Gon, "white patch" phenotype. 25% of males have a hermaphrodite vulval structure.
|
|
| DZ393 |
C. elegans |
mab-3(e1240) unc-4(e120) ref-1(ez11) II; him-8(e1489) IV. Show Description
Unc (cannot back). WT male tail.
|
|
| DZ841 |
C. elegans |
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
|
|
| EA90 |
C. elegans |
pag-1(ls2) dpy-17(e164) III. Show Description
Dpy. pag-1(ls2) is recessive and has not visible phenotype by itself. It increases the expression of certain lacZ fusion genes such as lacZmec-7, unc-86lacZ and unc-4unc-76lacZ.
|
|
| EAG16 |
C. elegans |
eagIs6[*fxIs10] II. Show Description
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.
|
|
| EAG25 |
C. elegans |
eagIs6[*fxIs10] ujIs113 II. Show Description
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. H2::mCherry marks germline nuclei. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.
|
|
| EAG28 |
C. elegans |
eagIs6[*fxIs10] II; ltIs44 IV. Show Description
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] IV. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. mCherry::PH marks cell membranes. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.
|
|
| EAK102 |
C. elegans |
eeeIs1. Show Description
eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]
|
|
| EAK103 |
C. elegans |
eeeIs2. Show Description
eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-45 3'UTR]. Motility defect. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]
|
|
| EC100 |
C. elegans |
eeEx100. Show Description
eeEx100 [his-24::GFP + rol-6(su1006)]. Rollers. Nuclear GFP fluorescence detected beginning with the eight-cell stage of the embryo in all somatic nuclei without the P-cell. In adults the GFP signal in somatic cells and in few hermaphrodites in undifferentiated germ nuclei and in oocytes and sperm. About 20% transmission.
|
|
| EC106 |
C. elegans |
eeEx106. Show Description
eeEx106 [hil-1::GFP + rol-6(su1006)]. GFP expression in body wall muscles, in the vulva sex muscles, in the marginal cells of the pharynx, in a limited number of head neurons, in the cytoplasm of excretory cells. The expression starts in the about 100-cell embryo in a few cells in the periphery in the nucleoplasm and in the nucleoli. Complex extrachromosomal arrary....pick Rollers. About 20% Rollers.
|
|
| ECA882 |
C. elegans |
ben-1(ean64) III. Show Description
Null allele of ben-1. Benzimidazole resistant. Can be used for benzimidazole resistance studies or selection. Reference: Hahnel SR, et al. PLoS Pathog. 2018 Oct 29;14(10):e1007226. doi: 10.1371/journal.ppat.1007226. PMID: 30372484.
|
|
| ED3033 |
C. briggsae |
C. briggsae wild isolate. Show Description
Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| ED3034 |
C. briggsae |
C. briggsae wild isolate. Show Description
Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| ED3035 |
C. briggsae |
C. briggsae wild isolate. Show Description
Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| ED3036 |
C. briggsae |
C. briggsae wild isolate. Show Description
Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| ED3037 |
C. briggsae |
C. briggsae wild isolate. Show Description
Isolated as a single hermaphrodite from rotting wood in the garden of a private residence in Tien Mu, Taipai, Taiwan, Oct. 2, 2005. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| ED3072 |
C. elegans |
C. elegans wild isolate. Show Description
Caenorhabditis elegans wild isolate. Isolated from compost from the Olive Mushroom Farms near the town of Limuru, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| ED3077 |
C. elegans |
C. elegans wild isolate. Show Description
Caenorhabditis elegans wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| ED3092 |
C. briggsae |
C. briggsae wild isolate. Show Description
Caenorhabditis briggsae wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| ED3101 |
C. briggsae |
C. briggsae wild isolate. Show Description
Caenorhabditis briggsae wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| EE31 |
C. elegans |
mup-2(e2346) unc-6(e78)/lon-2(e678) X. Show Description
Heterozygotes are WT and segregate WT, Lon and Uncs. If raised at 25C, the Uncs are Mup -> 3-fold/L1 arrest. If raised at 15C the Uncs are fertile (reduced brood).
|
|
| EEG107 |
C.elegans |
tph-1(mg280) II; mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. When tph-1 mutants carrying mudIs1 are exposed to blue light, the worms continue to move rather than stopping like wild-type animals. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
|
|
| EEG108 |
C. elegans |
mod-5(n822) I; mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
|
|
| EEG98 |
C. elegans |
mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
|
|
| EG1285 |
C. elegans |
lin-15B&lin-15A(n765) oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Integration maps at +2.0 on X. Expression of GFP in all GABAergic neurons.
|
|
| EG1653 |
C. elegans |
oxIs22 II. Show Description
oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Psoralen integration of oxEx129 [unc-49Bp(long)::GFP + lin-15(+)]. Dorsal and ventral.
|
|