| CB2337 |
C. elegans |
him-2(e1065) I; mab-3(e1240) II. Show Description
Lineage abnormal. Recessive. Segregates males. Males abnormal. |
|
| CB3168 |
C. elegans |
him-1(e879) I; mab-3(e1240) II. Show Description
Lineage abnormal. Bursae abnormal. Segregates abnormal males. M-MATING-NO SUCCESS. |
|
| CF80 |
C. elegans |
mab-3(mu15) II; him-5(e1490) V. Show Description
Abnormal V rays (male). |
|
| OH15732 |
C. elegans |
mab-3(ot931[mab-3::GFP::3xFlag]) II; him-5 (e1490) V. Show Description
GFP and 3xFlag tag inserted in endogenous mab-3 locus using the CRISPR SEC cassette (Dickinson 2015). sgRNA: ggtcaaaattatagatctt Insertion site: II: 9737290-9737291. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078. |
|
| DZ393 |
C. elegans |
mab-3(e1240) unc-4(e120) ref-1(ez11) II; him-8(e1489) IV. Show Description
Unc (cannot back). WT male tail. |
|
| OH20048 |
C. elegans |
mab-3(ot1666[mab-3::SL2::GFP::H2B]) II; him-8(e1489) IV. Show Description
SL2::GFP::H2B tag inserted at C-terminus of endogenous mab-3 locus. Him. crRNA: TGGTCAAAATTATAGATCTT. ssODN primers: FWD 5' GGAGTATGTATCTGAAAAATTATGGTCTGCAAGCCTAAgctgtctcatcctactttcacctag 3'; REV 5' ttttctaaaaatcaataattggtcaaaattatagatcctacttgctggaagtgtacttg 3'. Reference: Wang C, et al. Sci Adv. 2026 Apr 17;12(16):eaef1478. doi: 10.1126/sciadv.aef1478. PMID: 41996501. |
|
