Search Strains

sup-36 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.

DLM 19: sup-37 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.

Resistant to hydrogen sulfide.

Resistant to hydrogen sulfide.

Resistant to hydrogen sulfide.

otIs197 [unc-14p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. otIs197 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

otEx3165 [unc-120p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from muscle-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. otEx3165 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID*-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).

reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor for AID, and tissue-specific AID*-tagged blue protein in neuronal nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. Strain generated by crossing endogenously tagged unc-104::AID* into DV3805. reSi7 is at -5.32 cM. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).

wrdSi22 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541

krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008

Suppressed Unc-52. This strain was isolated after EMS mutagenesis of CB998 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to the unc-52 and sup-38 mutations, it is homozygous for 300 other mutations determined from sequence data. All mutations are annotated in WormBase. The e3003 and e998 mutations were present in the original CB998 strain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

WT in appearance and movement. Some slight body wall muscle disorganization. More severe gonad disorganization, and greatly reduced brood size. Suppresses the e444, e998, 669, e1012, e1421 and st196 alleles of unc-52.

WT in appearance and movement. Some slight body wall muscle disorganization. More severe gonad disorganization, and greatly reduced brood size. Suppresses the e444, e998, 669, e1012, e1421 and st196 alleles of unc-52.

Intragenic revertant (ra202) of original unc-112 mutation. WBPaper 00005804.

Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

Superficially wild-type. Temperature-sensistive. Maintain at 15C. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Animals are sterile or arrest development as larvae at when grown at 20-25C. Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.

Dpy. hsp-1(ra807) is a missense allele that replaces the conserved Ala379 residue to a Val residue in the ATPase domain of the HSP-1 protein and fully suppresses the bent-head phenotype of unc-23(e25). Reference: Rahmani P, Rogalski T, Moerman DG. (2015) Worm. In press.

raDf7 suppresses the paralyzed phenotype of unc-112(r367) because the deficiency deletes the dim-1 gene. Reduction or loss of the dim-1 gene product suppresses the unc-112(r367) phenotype. In this strain: Animals homozygous for raDf7 arrest as L1 or L2 larvae; Animals without raDf7 are paralyzed as adults; Animals heterozygous for raDf7 move reasonably well.

raEx16 [unc-112::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. raEx16 produces a fully functional GFP-tagged unc-112 protein that localizes to the dense bodies and M-line in muscle cells, and rescues the lethal phenotype of unc-112(st581) homozygous animals. Reference: Rogalski TM, et al. J Cell Biol. 2000 Jul 10;150(1):253-64.

C47E8.7. Heterozygotes are WT and segregate WT, Pat unc-112 homozygotes and Unc homozygotes. Pick WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC101.2a. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

raEx16 [unc-112::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. raEx16 produces a fully functional GFP-tagged unc-112 protein that localizes to the dense bodies and M-line in muscle cells, and will rescue the lethal phenotype of unc-112(st581) homozygous animals. Reference: Rogalski TM, et al. J Cell Biol. 2000 Jul 10;150(1):253-64.

raEx118 [T05G5.1p::ZK637.3 ORF(cDNA)::GFP + rol-6(su1006)]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx143 [T05G5.1p::M01E11.7 ORF(cDNA)::GFP + rol-6(su1006)]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx145 [T05G5.1p::Y71F9B.3 ORF(cDNA)::GFP + rol-6(su1006)]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx146 [T05G5.1p::C49H3.6 ORF(cDNA)::GFP + rol-6(su1006)]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx172 [T05G5.1p::F53E2.1 ORF(cDNA)::GFP + rol-6(su1006)]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx174 [T05G5.1p::T27A1.4 ORF(cDNA)::GFP + rol-6(su1006)]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx176 [T05G5.1p::Y39A1C.1 ORF(cDNA)::GFP + rol-6(su1006)]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx184 [T05G5.1p::F22D6.2 ORF(cDNA)::GFP + rol-6]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx210 [T05G5.1p::C32D5.9 ORF(cDNA)::GFP + rol-6]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx213 [T05G5.1p::T03G6.3 ORF(cDNA)::GFP + rol-6]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx219 [T05G5.1pW03F9.1 ORF(cDNA)::GFP + rol-6]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx226 [T05G5.1p::B0303.2 ORF(cDNA)::GFP + rol-6]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx237 [T05G5.1p::C08F8.1 ORF(cDNA)::GFP + rol-6]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx243 [T05G5.1p::C16C10.11 ORF(cDNA)::GFP + rol-6]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx245 [T05G5.1p::Y40B1B.7 ORF(cDNA)::GFP + rol-6]. Wild-type background with extrachromosomal array carrying dominant rol-6 and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Maintain by picking Rol-6 animals. WBPaper00038444.

raEx438 [pxl-1p::pxl-1a(cDNA)::GFP + rol-6(su1086)]. Rollers. Transgene does not rescue ok1483 L1 lethality. Transgenic (Rol) heterozygotes segregate rolling non-Dpy (heterozygotes carrying raEx438), non-rolling non-Dpy (heterozygotes without the array), arrested L1 (ok1483 homozygotes) and sterlie Dpy (mT1 homozygotes). Pick rolling non-Dpy and check for correct segregation of progeny to maintain. Reference: Warner A, et al. Mol Biol Cell. 2011 Jul 15;22(14):2551-63.

raEx151 [cpna-1::YFP + rol-6(su1006)]. GFP inserted into WRM0617dC02 fosmid at 3' end of cpna-1 gene. WRM0617dC02 fosmid with YFP inserted into the F31D5.3/cpna-1 gene in frame at its 3' end by recombineering. YFP expression in body wall muscle cells at dense bodies and M-lines; weak expression in the pharynx. Pick Rollers to maintain. Reference: Warner A, et al. Mol Biol Cell. 2013 Mar;24(5):601-16.

nIs590 [fat-7p::fat-7::GFP + lin15(+)] V.  Derived by X-ray integration of waEx15. The fat-7::fat-7::GFP translational reporter is activated by 15C or acdh-11 loss-of-function. See Ma et al., Cell. 2015 May 21; 161(5): 1152–1163.

nIs590 [fat-7p::fat-7::GFP + lin15(+)] V.  The fat-7::fat-7::GFP translational reporter is activated constitutively by loss of acdh-11 function. acdh-11(n5878) is a 366 bp deletion. Reference: Ma et al., Cell. 2015 May 21; 161(5): 1152–1163.

nIs470 [cysl-2p::GFP + myo-2p::mCherry] IV.  The cysl-2::GFP reporter is activated by HIF-1 in egl-9, rhy-1 or vhl-1 loss-of-function mutants.

For PCR STS mapping. Differs from RW7000 in two Tc1 sites. Caenorhabditis elegans wild isolate. DP subclone of RW7000. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

edIs6 [unc-119::GFP + rol-6(su1006)] IV. Strong Roller phenotype. Hets are not Rollers (despite the presence of the supposedly dominant su1006 mutation in the array), so heterozygous males mate well. edIs6 is the integration of an array carrying pDP#MMUGF12 and pRF4. pDP#MMUGD12 ia an unc-119::GFP fusion that encodes 101 aa of UNC-119 and was made from the Fire lab vector pPD95.77. pRF4 is the rol-6(su1006) plasmid that gives a Rol phenotype. This strain allows the nervous system to be visualized by GFP fluorescence. GFP expression starts in the early embryo and continues through adulthood in most, if not all, of the nervous system. The expression of a similar lacZ fusion (but carrying a nuclear localizing signal) is described in Genetics 141: 977-988 1995.

Unc. Contains an unlinked dauer constitutive mutation. See HT1593 for a stock with the Daf mutation removed.

Homozygotes for this mutation express a dumpy phenotype, while heterozygotes are roller and slightly shorter-than-wildtype in length. This Ctr-dpy-10 mutation will serve as a suitable syntenic marker for chromosome II mutations in C. tropicalis that does not impact the viability or fecundity of the organism. Generated in a C. tropicalis JU1373 background. Hermaphrodite. Culture at 20°C or above.

Homozygotes lack obvious gross phenotypes; miR-43(sjm1) accumulates in L4 larvae compared to wild-type miR-43. mir-43(sjm1) has an inversion of the miR-43 seed sequence. Reference: Stubna MW, et al. bioRxiv doi: 10.1101/2024.06.28/601170.