Search Strains

SL2::GFP::HIS-44 tag inserted into the endogenous ins-7 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

GFP tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. [NOTE: Previously described as ceh-44(syb5437[gfp::ceh-44]) III. ceh-44 and cone-1 are located in the same locus and may share many exons, but are two separate genes with different functions and expression patterns. Please contact Oliver Hobert prior to publishing work using this strain.

SL2::GFP::HIS-44 tag inserted into the endogenous ins-18 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

oxGFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. Broad punctate expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

SL2::GFP::HIS-44 tag inserted into the endogenous ins-33 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID* after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.

Cre inserted into the endogenous egl-3 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

GFP tag inserted at the N-terminus of the endogenous ceh-44 locus by CRISPR. Pan-neuronal nuclear expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

Cre inserted into the endogenous ceh-48 locus by CRISPR. Pan-neuronal expression of Cre. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

GFP tag inserted at the C-terminus of the endogenous T07A9.10 locus by CRISPR. Punctate ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

C39D10.6. GFP tag inserted at the C-terminus of the endogenous latd-1 locus by CRISPR. Punctate GFP expression in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

SL2::GFP::HIS-44 tag inserted into the endogenous ins-35 locus. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

GFP tag inserted at exon 7 of the endogenous ceh-44 locus by CRISPR. Nuclear pan-neuronal nuclear and broad punctate expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

GFP tag inserted at the C-terminus of the endogenous syx-3 locus by CRISPR. Ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

GFP tag inserted at the C-terminus of the endogenous unc-13 locus by CRISPR. Nuclear neuronal and hypodermal expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

Conditional knockout of dmsr-1 created via consecutive insertion of two FRT sites (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) flanking the second and third exons. The sequence within the two FRT sites is predicted to encode the first four transmembrane alpha helices. FLP recombination excises this sequence and introduces a frameshift, resulting in a likely molecular null allele of dmsr-1. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.

GFP tag inserted at the N-terminus of the endogenous W02D7.3 locus by CRISPR. Expression of GFP in pharynx, excretory gland cell, and some additional cells in the head. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

T07A9.10. syb6377 deletion removes all but exon 1 and part of exon 2 of uncp-18 locus. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

GFP tag inserted at the C-terminus of the endogenous Y71G12B.26 locus by CRISPR. Expression of GFP in pharynx and excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

tagRFP tag inserted at the C-terminus of the endogenous F36D1.23 locus by CRISPR. Strong and specific expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

GFP tag inserted into endogenous fat-6 locus using Crispr/Cas9. fat-6::GFP expression in intestine and hypodermis. No obvious phenotype, but the fat-6 locus is likely inactive in this strain. Reference: Bodhicharla R, et al. Genetics. 2018 Sep;210(1):189-201.

GFP tag inserted at the N-terminus of the endogenous unc-75 locus by CRISPR. Pan-neuronal nuclear expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

GFP tag inserted at the C-terminus of the endogenous spex-2/F36D1.7 locus by CRISPR. Expression of GFP in excretory gland cell. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

wrmScarlet tag inserted at the N-terminus of the endogenous golg-2 locus by CRISPR. Broad punctate wrmScarlet expression. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

GFP tag inserted at the C-terminus of the endogenous unc-64 locus by CRISPR. Ubiquitous expression of GFP. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

GFP tag inserted at C-terminus of endogenous cone-1 locus by CRISPR. Broad nuclear GFP expression in non-neuronal cells. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.

Endogenous nlp-7 locus (B-isoform) tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.

Broad puncate expression in non-neuronal cells, later expression initiatiated ~1.5-2 fold stage. wrmScarlet tag inserted at the N-terminus of the endogenous cone-1 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.

Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.

Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.

Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.

GFP tag inserted in exon 4 of endogenous ceh-44 locus. Broad, weak, punctate GFP expression in non-neuronal cells. Please contact Oliver Hobert prior to publishing work using this strain.

Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.

Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.

90% reduced cathepsin D. Cleaner genetic background than PJ1 cad-1(j1); this strain has been outcrossed 2X.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted at 3' end of endogenous src-1 locus using CRISPR/Cas9 engineering. gRNA sequence: AGCACAATTTTTTAGGCACT

apIs320 [let-7::unc-119(+)] II. PQ425 was created by crossing PQ320 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.

apIs404 [let-7(delta alg-1-binding site)::unc-119(+)] II. PQ426 was created by crossing PQ404 into unc-3(e151) let-7(mn112) animals, which do not express precursor or mature let-7. unc-119(ed3) might not be homozygous in this strain. Reference: Zisoulis DG, et al. Nature. 2012;486(7404):541-544.

Temperature sensitive. Unc-difficulty in crawling backwards. Behavior phenotype more pronounced at 25C than at 16C or 20C. Trichlorfon resistant. This strain replaced strain DH401 because Mike Nonet tested DH401 and found it didn't contain cha-1, but did have an unc-11 mutation (5/97).

mutEx70 [pmk-1::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. [NOTE: This strain has been incorrectly referred to as RP112 muEx70.] Reference: Mertenskötter A, et al. Cell Stress Chaperones. 2013 May;18(3):293-306.

Male-female strain. Gonochoristic. Grows well on OP50. Freezes well with C. elegans protocol. Isolated by Robin Giblin-Davis in October 1990 in Dade County, FL in the abdomen of an adult female of Metamasius hemipterus. Consult Walter Sudhaus or Robin Giblin-Davis for appropriate taxonomy before publication. Do not distribute this strain; other labs should request it from the CGC. sp. 3 in Kiontke and Sudhaus Wormbook Ecology chapter.

Heterozygotes are Lon non-Unc. Df/Df is embryonic lethal. Maintain by picking single Lon non-Unc and check for dead embryos-->Lon non-Unc recombinants that have lost the Df arise frequently. Does not survive long periods of starvation-->survivors tend to be Lon non-Uncs without the Df. Do not distribute this strain; other labs should request it from the CGC.

syIs1 [lin-3(genomic) + rol-6(su1006)]. Animals are Muv due to over-expression of lin-3. Unknown if unc-31(e169) is present in this strain. See also WBPaper00004853. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations.

Panagrellus redivivus. Not hermaphroditic. Sexes separate. Growth Slow. Do not distribute this strain; other labs should request it from the CGC.

Do not distribute this strain; other labs should request it from the CGC.

Do not distribute this strain; other labs should request it from the CGC.

Bivulva. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Do not distribute this strain; other labs should request it from the CGC.

sli-1 is a silent suppressor of the Vul phenotypes of let-23(lf) mutants. sy1;sy143 animals are Hyperinduced. Do not distribute this strain; other labs should request it from the CGC.