GFP tag inserted at the C-terminus of the endogenous pha-4 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Please contact Oliver Hobert prior to publishing work using this strain.

CRISPR/Cas9 engineered tagged endogenous locus.

Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

Heterozygotes are WT and segregate WT, Females which lack a pharynx (arrest as embryos or L1) and Sterile Unc Rollers. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. See also WBPaper00003770.

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. bqSi225 [emr-1p::emr-1::mCherry + unc-119(+)] IV. gwIs59 [pha-4::mCherry::256xLacO::4xLexA + unc-119(+)]. Superficially wild-type. Express ubiquitous EMR-1::mCherry at the nuclear periphery. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red intestine (all stages) and green intestine (from late L4 stage). Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421.

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. ygIs2 [baf-1::GFP::lmn-1(Y59C) + unc-119(+)]. caIs3 [pha-4::lacZ + rol-6(su1006)]. Rollers. Strain expressing low level of GFP::LMN-1 (carrying the Y59C mutation). Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Mattout A, et al. Curr Biol. 2011 Oct 11;21(19):1603-14. doi: 10.1016/j.cub.2011.08.030. PMID: 21962710

ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570.

wgIs37 [pha-4::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of pha-4 coding sequence of fosmid ID#WRM0617dE06 by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10007 [pha-4 (4.1kb)) H3::H3::GFP::H3 3'UTR + pie-1p::H2B::GFP::pie-1 3'UTR + pha-4p::H1::DsRed::T1::let-858 3'UTR]. May still contain ruIs32 [pie-1::H2B-GFP + unc-119(+)] in the background.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10050 [pha-4(4kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]

pxIs10 [pha-4::GFP::CAAX + rol-6(su1006)]. Roller line that has GFP localized to the plasma membrane of the pharynx, gut and rectal cells in embryos and the somatic gonad during L2-L3 larval stage and beyond. Reference: Portereiko MF & Mango SE. Dev Biol. 2001 May 15;233(2):482-94.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10077 [pha-4p(I2L)::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).