OH15876 |
C. elegans |
pha-4(ot946[pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous pha-4 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
RW12220 |
C. elegans |
pha-4(st12220[pha-4::TY1::EGFP::3xFLAG]) V. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
|
|
SM190 |
C. elegans |
smg-1(cc546) I; pha-4(zu225) V. Show Description
Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
JK1521 |
C. elegans |
fog-2(q71) pha-4(q490)/stu-3(q265) rol-9(sc148) V. Show Description
Heterozygotes are WT and segregate WT, Females which lack a pharynx (arrest as embryos or L1) and Sterile Unc Rollers. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. See also WBPaper00003770.
|
|
GW1394 |
C. elegans |
gwIs39 III; bqSi225 IV; gwIs59. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. bqSi225 [emr-1p::emr-1::mCherry + unc-119(+)] IV. gwIs59 [pha-4::mCherry::256xLacO::4xLexA + unc-119(+)]. Superficially wild-type. Express ubiquitous EMR-1::mCherry at the nuclear periphery. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red intestine (all stages) and green intestine (from late L4 stage). Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421.
|
|
GW513 |
C. elegans |
gwIs39 III; ygIs2; caIs3. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. ygIs2 [baf-1::GFP::lmn-1(Y59C) + unc-119(+)]. caIs3 [pha-4::lacZ + rol-6(su1006)]. Rollers. Strain expressing low level of GFP::LMN-1 (carrying the Y59C mutation). Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Mattout A, et al. Curr Biol. 2011 Oct 11;21(19):1603-14.
doi: 10.1016/j.cub.2011.08.030. PMID: 21962710
|
|
OD1854 |
C. elegans |
ltSi539 II; ltSi507 IV; nre-1(hd20) lin-15B(hd126) X; stIs10389. Show Description
ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3UTR + cnd-1p::mCherry::his-72::unc-54 3UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3UTR + hlh-1p::mCherry::his-72::tbb-2 3UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570.
|
|
OH19118 |
C. elegans |
otIs913 V. Show Description
otIs913 [pha-4(prom2)::daf-2(DN)::eBFP2::tbb-2 3 UTR + unc-122p::mCherry::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. pha-4(prom2) drives expression of daf-2(DN) in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
|
|
OP37 |
C. elegans |
unc-119(ed3) III; wgIs37. Show Description
wgIs37 [pha-4::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of pha-4 coding sequence of fosmid ID#WRM0617dE06 by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
PHX5755 |
C. elegans |
pha-4(ot946 ot1078 syb5755[pha-4::3xGAS::GFP::3xGAS::AID::TEV::LoxP::3xFLAG]) V. Show Description
Endogenously-tagged pha-4 locus allele modified for auxin dependent protein degradation. ot946 [pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]. ot1078 added a second loxP site to the first intron (+278). syb5755 added 3xGAS::AID after the GFP tag. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
RW10007 |
C. elegans |
pha-1(e2123) stIs10007 III; zuIs178 V. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10007 [pha-4 (4.1kb)) H3::H3::GFP::H3 3'UTR + pie-1p::H2B::GFP::pie-1 3'UTR + pha-4p::H1::DsRed::T1::let-858 3'UTR]. May still contain ruIs32 [pie-1::H2B-GFP + unc-119(+)] in the background.
|
|
RW10062 |
C. elegans |
unc-119(ed3) III; zuIs178 V; stIs10050. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10050 [pha-4(4kb)::HIS-24::mCherry + unc-119(+)]. May still contain stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)] in the background.
|
|
RW10425 |
C. elegans |
unc-119(ed3) III; ltIs37 IV; stIs10116; stIs10389. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72(promoter)::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.]
|
|
SM481 |
C. elegans |
pxIs10. Show Description
pxIs10 [pha-4::GFP::CAAX + rol-6(su1006)]. Roller line that has GFP localized to the plasma membrane of the pharynx, gut and rectal cells in embryos and the somatic gonad during L2-L3 larval stage and beyond. Reference: Portereiko MF & Mango SE. Dev Biol. 2001 May 15;233(2):482-94.
|
|
OH19078 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID]) I; otIs908 V. Show Description
otIs908 [pha-4prom2::TIR1(F79G)::mTur2::tbb-2 3 UTR + unc-122p::mCherry::unc-54 3' UTR] V. TIR1(F79G) expression in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https://doi.org/10.1101/2025.01.06.631508.
|
|
SD1345 |
C. elegans |
ccIs4251 I; stIs10077. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10077 [pha-4p(I2L)::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
|
|