AD294 |
C. elegans |
cylc-2(mon2[cylc-2::mNG::3xFLAG) I; him-5(e1490) V. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
|
|
AGK192 |
C. elegans |
unc-119(ed3) III; zdIs13 IV; armIs5. Show Description
zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.
|
|
AGK280 |
C. elegans |
zfp-1(ok554) unc-119(ed3) III; armEx14. Show Description
armEx14 [PHD1-PHD2::FLAG + zfp-1(short isoform) + unc-119(+)]. Pick non-Unc animals to maintain. The fosmid-based armEx14 transgene rescues zfp-1(ok554)/nDf17 lethality. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
|
|
AGK369 |
C. elegans |
zfp-1(ok554) III; armIs8. Show Description
armIs8 [zfp-1(short isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs8 transgene rescues the protruded vulva phenotype of zfp-1(ok554). Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
|
|
AGK370 |
C. elegans |
zfp-1(ok554) III; armIs9. Show Description
armIs9 [zfp-1(long isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs9 transgene rescues zfp-1(ok554)/nDf17 lethality. Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
|
|
AH5059 |
C. elegans |
let-23(zh131[FRT::let-23::FRT::GFP::LoxP::FLAG::let-23]) II. Show Description
CRISPR allele of endogenous let-23, which expresses let-23::GFP fusion protein and is susceptible for conditional knock-out via incorporated FRT sites with FLPase expression. Reference: Konietzka et al. 2019. Current Biology (accepted).
|
|
BB259 |
C. elegans |
adr-1(uu49) I; adr-2(uu28) III; ggIs1 IV. Show Description
ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)] IV. Nuclear GFP::NRDE-3 signal. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
|
|
BB278 |
C. elegans |
adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) III; ggIs1 IV. Show Description
ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)] IV. Nuclear GFP::NRDE-3 signal. Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282.
|
|
BN646 |
C. elegans |
bqSi640 II; bqSi470 IV. Show Description
bqSi640 [dpy-7p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi470 [hsp-16.41p::FLAG::NLS::FLP D5 + unc-119(+)] IV. Expression of red and green histones in hypodermal lineage before and after heat shock, respectively.
|
|
BR7827 |
C.elegans |
endu-2(tm4977) X; byEx1551. Show Description
byEx1551 [vha-6p::endu-2::eGFP::3xFLAG + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. Transgene provides intestinal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.
|
|
BR8551 |
C.elegans |
endu-2(tm4977) X; byEx1795. Show Description
byEx1795 [unc-119p::endu-2::eGFP::3xFlag + rol-6(su1006)]. Pick Rollers to maintain. Transgene provides neuronal rescue of endu-2(tm4977) that also rescues mortal germline (Mrt) phenotype. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.
|
|
CA1369 |
C. elegans |
zhp-1(ie62[zhp-1::AID::3xFLAG]) I; meIs8 II; spo-11(ie59[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CA1377 |
C. elegans |
zhp-2(ie67[zhp-2::AID::3xFLAG]) I; meIs8 II; spo-11(ie60[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CA1421 |
C. elegans |
meIs8 II; dsb-2(ie58[dsb-2::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CA1423 |
C. elegans |
meIs8 II; spo-11(ie59[spo-11::AID::3xFLAG]) ieSi38 IV. Show Description
meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.
|
|
CU7905 |
C. elegans |
smIs350 IV; unc-76(e911) V. Show Description
smIs350 [hsp-16::mCherry-NLS + tra-2::FLAG(3x) + unc-76(+)] IV. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.
|
|
CZ25013 |
C. elegans |
unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. Show Description
unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
|
|
CZ26494 |
C. elegans |
juSi364 IV; acr-2(n2420) X. Show Description
juSi364 [unc-17Bp::3xFLAG::eif-3.g::SL2::GFP] IV. GFP expression in cholinergic motor neurons. Convulsing worms. Strain is suitable for neuron-type eCLIP. Reference: Blazie S, et al. Elife. 2021 Jul 29;10:e68336. PMID: 34323215.
|
|
CZ27748 |
C. elegans |
vwa-8(ju1799[vwa-8::GFP::3xFLAG]) X. Show Description
Endogenous vwa-8 locus tagged with GFP and 3xFLAG. VWA-8::GFP is expressed in mitochondria of hypodermis, intestine, and muscle, but not detectable in neurons. Reference: Zhu, M, et al. A null mutation of C. elegans vwa-8. microPublication Biology. https://doi.org/10.17912/micropub.biology.000263.
|
|
DA2356 |
C. elegans |
ced-1(e1735) I; ced-3(n717) IV; lin-15B&lin-15A(n765) X; adEx2342. Show Description
adEx2342 [efl-3::mCherry::FLAG + LIN-15(+)]. Maintain by picking non-Muv. Fluorescence is dim, but array is stable (>95% transmission).
|
|
DE115 |
C. elegans |
dnSi8 I; unc-119(ed3) III; dnIs22. Show Description
dnSi8 [tdp1::flag::mCherry + Cbr-unc119(+)] inserted into ttTi5605 on LG II. Nuclear-localized mCherry. dnIs22 [sup-46::GFP + unc-119(+)] (site of integration unknown). Strong nuclear-localized GFP expression. [NOTE: This strain was produced by crossing two parental strains carrying strong unc-119 loss of function alleles. One parent was carrying ed3; the allele in the other parental strain is unknown.]
|
|
DE130 |
C. elegans |
unc-119(e2488) III; dnIs24. Show Description
dnIs24 [sup46::flag::mCherry + Cbr-unc-119(+)]; site of integration unknown. Strong nuclear-localized mCherry.
|
|
DG4158 |
C. elegans |
spn-4(tn1699[spn-4::gfp::3xflag]) V. Show Description
Apparently wild type
|
|
DG4190 |
C. elegans |
cdc-25.3(tn1712[gfp::3xflag::cdc-25.3]) III. Show Description
Superficially wild type
|
|
DG4213 |
C. elegans |
meg-1(tn1724[gfp::3xflag::meg-1]) X. Show Description
Superficially wild type
|
|
DG4215 |
C. elegans |
puf-5(tn1726[gfp::3xflag::puf-5]) II. Show Description
Superficially wild type
|
|
DG4218 |
C. elegans |
cpg-1(tn1728[mng::3xflag::cpg-1]) III. Show Description
Superficially wild type
|
|
DG4222 |
C. elegans |
pos-1(tn1730[gfp::3xflag::pos-1]) V. Show Description
Superficially wild type
|
|
DG4228 |
C. elegans |
orc-1(tn1732[mNeonGreen::3xflag::orc-1]) III. Show Description
Superficially wild type
|
|
DG4230 |
C. elegans |
gla-3a(tn1734[gfp::3xflag::gla-3a]) I. Show Description
Superficially wild type
|
|
DG4233 |
C. elegans |
pqn-59(tn1737[gfp::3xflag::pqn-59]) I. Show Description
Superficially wild type
|
|
DG4269 |
C. elegans |
mex-3(tn1753[gfp::3xflag::mex-3]) I. Show Description
Superficially wild type
|
|
DG4392 |
C. elegans |
cyb-3(tn1755[gfp::3xflag::cyb-3]) V. Show Description
Although this strain is maintainable as a homozygote it produces many dead embryos (~80%) and has a low viable brood size (~24 ± 18). Thus, the GFP tag compromises CYB-3 function.
|
|
DG4569 |
C. elegans |
cyb-1(tn1806[cyb-1::gfp::tev::3xflag]) IV. Show Description
Viable and fertile, grows and moves well. No apparent abnormalities yet noted. Reference: Spike CA, et al. Genetics. 2022 May 5;221(1):iyac051.
doi: 10.1093/genetics/iyac051. PMID: 35377419
|
|
DQM455 |
C. elegans |
cki-1(bmd132[GFP::LoxP::cki-1::3xFLAG]) II. Show Description
CRISPR/Cas9 insertion of GFP into the N-terminus of cki-1; seems to cause cki-1 gain-of-function phenotype (early cell cycle exit for some post-embryonic blast cells). Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888
|
|
DV3089 |
C. elegans |
rheb-1(re64[mKate2::3xFlag::rheb-1]) III. Show Description
mKate tag inserted at 5' end of endogenous rheb-1 locus. Ubiquitous expression.
|
|
DV3285 |
C. elegans |
his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background.
C-terminally tagged mpk-1 is detectable by triplex PCR:
mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG
mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC
mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC
Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
|
|
DV3312 |
C. elegans |
rgl-1(re179[mNeonGreen::3xFlag::rgl-1]) X. Show Description
Ubiquitous expression with cytosolic localization. Derived in an N2 background.
Detection with triplex primers:
HS125 5-CTTGTCACTGTAAGGGAAGATTTCC-3
HS126 5-TTGTCCTCCTCTCCCTTGG-3
HS127 5 ACGTAGAATGTTCCAGAGTTCCAG-3'
Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
DV3327 |
C. elegans |
pmk-1(re170[pmk-1::mNG::3xFlag]) IV. Show Description
mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
DV3402 |
C. elegans |
ral-1(re218[mKate2::3xFlag::ral-1]) III. Show Description
Ubiquitous expression and localization to plasma membranes. Derived in an N2 background.
TD185 5 -GCCGGAAGAGTGATGAACCC- 3
TD186 5 -TAATGAGCTCGGAGACCATGGC- 3
TD187 5 -CGCACCTCATCATACATGAACTGC- 3
Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
|
|
DV3670 |
C. elegans |
rheb-1(re64 re285[AID::mKate2::3xFlag::rheb-1]) III. Show Description
AID tag in 5' end of mKate2-tagged endogenous rheb-1. Ubiquitous red expression.
|
|
DZ710 |
C. elegans |
fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II. Show Description
fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II.
|
|
DZ840 |
C. elegans |
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III.
|
|
DZ841 |
C. elegans |
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
|
|
EGD615 |
C.elegans |
cox-4(zu476[cox-4::eGFP::3XFLAG]) I; egxSi136 II; unc-119(ed3) III. Show Description
egxSi136 [mex-5p::tomm-20::halotag::pie-1 3UTR + unc-119(+)] II. GFP and 3xFLAG tags inserted into endogenous cox-4 locus to create a C-terminal translational GFP fusion. Outer membranes are stably labeled with the TOMM-20::Halotag transgene, and the mitochondria matrix are labeled with COX-4::GFP. Reference: Fan X, et al. G3 (accepted).
|
|
EV343 |
C. elegans |
unc-119(ed3); efEx12. Show Description
efEx12 [glp-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. GFP expression in the proliferative region of the germ line (resembling endogenous GLP-1 protein localization), and also in spermatheca and other somatic tissues. Derived by bombarding strain DP38 with LAP-tagged glp-1 fosmid (WRM0630DF02).
|
|
EV484 |
C. elegans |
efIs155 II. Show Description
efIs155 [mex-5p::rpl-4::FLAG::tbb-2 3?UTR + Cbr-unc-119(+)] II. Tagged RPL-4 can be used for ribosome purifications from germ cells. Reference: Nousch M, et al. G3 (Bethesda). 2020 Sep 3:g3.401644.2020. doi: 10.1534/g3.120.401644
|
|
FGP29 |
C. elegans |
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I; ieSi38 IV. Show Description
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
|
|
FGP30 |
C. elegans |
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I; ltIs37 IV. Show Description
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
|
|
GLW25 |
C. elegans |
daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
|
|