Strain Information

Name PHX6333   View On Wormbase
Species C. elegans
Genotypedmsr-1(syb6331 syb6333[FRT::dmsr-1 exons 2-3::FRT]) V.
DescriptionConditional knockout of dmsr-1 created via consecutive insertion of two FRT sites (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) flanking the second and third exons. The sequence within the two FRT sites is predicted to encode the first four transmembrane alpha helices. FLP recombination excises this sequence and introduces a frameshift, resulting in a likely molecular null allele of dmsr-1. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.
MutagenCrispr/Cas9
Outcrossedx0
Made bySunyBiotech / Henrik Bringmann
Laboratory HBR
Reference “The neuropeptide FLP-11 induces and self-inhibits sleep through the receptor DMSR-1 in Caenorhabiditis elegans” doi: 10.1016/j.cub.2025.03.039.
Sign in or register an account if you want to order this strain.