Strain Information
| Name | PHX6333 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | dmsr-1(syb6331 syb6333[FRT::dmsr-1 exons 2-3::FRT]) V. |
| Description | Conditional knockout of dmsr-1 created via consecutive insertion of two FRT sites (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) flanking the second and third exons. The sequence within the two FRT sites is predicted to encode the first four transmembrane alpha helices. FLP recombination excises this sequence and introduces a frameshift, resulting in a likely molecular null allele of dmsr-1. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | SunyBiotech / Henrik Bringmann |
| Laboratory | HBR |
| Reference | “The neuropeptide FLP-11 induces and self-inhibits sleep through the receptor DMSR-1 in Caenorhabiditis elegans” doi: 10.1016/j.cub.2025.03.039. |
Sign in
or
register an account if you want to order this strain.