More Fields
Strain Species Genotype
PS8313 C. elegans nlp-79(sy1268) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-79; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaattaaattcaacttttcaggtaaaATGTCCACT Right flanking sequence: CGGTGGTTTGTGTTCGTCGCCCTGATGGCTCTCG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CAGGTAAAATGTCCACTCGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PHX7564 C. elegans nlp-79(syb7564[nlp-79::SL2::GFP::H2B]) IV. Show Description
Endogenous locus tagged with SL2::GFP::H2B using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.